Research Article |
|
Corresponding author: Ammar Kubba ( kubbaammar1963@gmail.com ) Academic editor: Plamen Peikov
© 2022 Yahya Yaseen, Ammar Kubba, Wurood Shihab, Lubna Tahtamouni.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Yaseen Y, Kubba A, Shihab W, Tahtamouni L (2022) Synthesis, docking study, and structure-activity relationship of novel niflumic acid derivatives acting as anticancer agents by inhibiting VEGFR or EGFR tyrosine kinase activities. Pharmacia 69(3): 595-614. https://doi.org/10.3897/pharmacia.69.e86504
|
A new series of niflumic acid (NF) derivatives were synthesized by esterification of (NF) to give ester compound 1, which was treated with hydrazine hydrate to produce (NF) hydrazide 2. Hydrazine-1-carboxamide compounds (3A–C), and hydrazine-1-carbothioamide derivatives (4A–D) were synthesized by treatment of (NF) hydrazide with phenyl isocyanate, and phenyl isothiocyanate derivatives, respectively. The cyclization of (4B–D) and (3B) was achieved using NaOH solution to produce 1,2,4-triazole derivatives (5A–C) and 6, respectively. The prepared compounds were characterized using IR, 1HNMR, 13CNMR, and MS (ESI) spectroscopy. A molecular docking study was performed to evaluate the binding affinity of the synthesized compounds against EGFR and VEGFR kinase domains which revealed that compounds 3B, and 4A had the best binding energy (-7.87, and -7.33 kcal/mol, respectively) against VEGFR, while compound 5A had the best binding energy (-7.95 kcal/mol) against EGFR. The biological investigation results indicated that all the tested compounds caused cell killing in the two cancer cell lines (Hep G2 and A549) studied, with compound 4C being the most cytotoxic, as well as being cancer selective. Additionally, compound 4C-treated Hep G2 cells were arrested at the S and G2/M cell cycle phases. Cytotoxicity of compound 4C was attributed to apoptosis as determined by flow cytometry and qRT-PCR results of the apoptosis markers p53, BAX, and caspase-3. Finally, compound 4C inhibited VEGFR kinase activity, while compound 5B inhibited EGFR kinase activity. In conclusion, the novel (NF) derivatives are potent anticancer agents, inhibiting cell proliferation by inhibiting EGFR and VEGFR tyrosine kinase enzymes.
ADMET, Apoptosis, EGFR kinase activity, MTT assay, 1,2,4 Triazole, VEGFR kinase activity.
Cancer is a malignant illness in which cancer cells divide aberrantly without control, and it has been one of the world’s biggest health issues for decades. Cancer affects a wide population of people around the world, and if not treated appropriately, it can cause invasion into the surrounding tissue, spread to other regions of the body, and become a significant health problem (
Angiogenesis control is one of the main focuses for cancer therapy. One key aspect of the angiogenesis therapy is targeting the vascular endothelial growth factor (VEGF), whose family consists of five related glycoproteins (
On the other hand, certain types of cancer are treated using epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors. EGFR is found on the surface of normal cells and aids in cell development. However, the highest concentration of EGFR is found in malignant cells, which aids in their growth and division. As a result, inhibiting EGFR will halt cancer cell proliferation (
The chemical properties of 1,2,4-triazoles, and their heterocyclic fusion derivatives have attracted great interest in recent decades, due to their various biological effects (
Niflumic acid was purchased from Sigma-Aldrich. The infrared spectra were recorded using Shimadzu Specac GS 10800-R IR Affnity-1 Spectrophotometer (ύ = cm-1). The mass spectra were recorded on Api 3200 triple quadruple, ESI system (Applied Biosystem). 1HNMR spectra of the synthesized compounds were measured on AVANCE-III 300MHz Nanobay FT-NMR spectrometer, using tetramethylsilane (TMS), as an internal standard, the chemical shift was displayed once as (δ, ppm), and DMSOd6 was utilized as a solvent.
A suspension of niflumic acid (0.035 mol, 10 g) in 85 mL abs. EtOH was cooled down to -15 °C, then an excess amount of thionyl chloride (SOCl2) was added drop by drop (0.035 mol, 10.28 mL, 4.21 g). The temperature was kept below -10 °C. The reaction mixture was kept at a temperature of 40 °C for 3 h on a magnetic stirrer, then it was refluxed for 48 h, and left at RT overnight. The solvent was evaporated to dryness, then re-dissolved in abs. EtOH, and evaporated once more. The process was repeated to make sure that all excess SOCl2 was removed. The product was then washed with 10% NaOH. The residue was collected and recrystallized from 70% EtOH.
Brown powder, yield (55%), m.p = 65–68 °C, Rf. = 0.47. ATR-FTIR (ύ, cm-1): 3264 (NH) str, 2925, 2858 (CH) str. of aliph (CH2) and (CH3), 1689 (C = O) str. of (conj ester), 1620 (C = N) str, 1582, 1534, 1498Ar (C = C) str.1403 (C-F) str, 1290 (C-N) str.
1H-NMR (300MHz, DMSOd6, δ = ppm): 10.29 (s, 1H, NH), 8.45–8.28 (m, 3H, Ar-H), 7.85 (d, 1H, Ar-H), 7.52–7.33 (d, 2H, Ar-H), 6.95 (s, 1H, Ar H), 4.36 (q, 2H, CH2), 1.27 (t, 3H, Ar-H).
13CNMR (75MHz, DMSOd6, δ = ppm): 166.80 (C = O), 154.88 (ArC = N), 152.96, 140.56, 140.42, 129.90, 123.76 (CF3), 118.57, 115.97, 114.99, 107.93, 61.56 (CH2), 14.11 (CH3).
MS (ESI) m/z: Calcd. for C15H13F3N2O2 [M]+ 310.09, found 310.90
Niflumic ethyl ester (compound 1) (0.008 mol, 2.5 g), and hydrazine hydrate 80% (an excess amount of 0.0215 mol, 0.25 g, 5 mL) was added to 50 mL of EtOH in a 100 mL R.B flask, and the mixture was stirred overnight at RT, then it was set to reflux at 80 °C for 14 h. At the end of the reflux time, the mixture was stirred overnight at RT. Later, the mixture was then poured on crushed ice. The formed ppt was filtered off, and washed thoroughly with cold D.W. Then the ppt was allowed to dry, until being recrystallized from abs. EtOH.
White powder, yield (80%), m.p = 139–142 °C, Rf. = 0.17. ATR-FTIR (ύ, cm-1): 3306, 3205 (NH2) str of prim amine , 1603 (C = O) str. of amide (amide I band), 1534, and 1445 Ar (C = C) str , 1400 (C-F) str, 1338 (C-N) str.
1HNMR (300MHz, DMSOd6, δ = ppm): 11.03 (s, 1H, NH), 10.13 (s, 1H, NH), 8.37–8.30 (d, 2H, Ar-H), 8.08 (s, 1H, Ar-H), 7.81, (d, 1H, Ar-H), 7.53 (t, 1H, Ar-H), 7.29 (d, 1H, Ar-H), 6.93(d,1H,Ar-H), 4.65 (s, 2H, NH2).
13CNMR (75MHz, DMSOd6,δ = ppm): 166.63 (C = O), 153.91 (ArC = N), 150.38, 141.17, 136.60, 129.95, 122.77 (CF3), 117.66, 114.87, 114.56, 111.17.
MS (ESI) m/z: Calcd. for C13H11F3N4O [M]+ 296.09, found 296.8.
To a solution of compound (2) (0.00084 mol, 0.25 g,) in 25 mL of EtOH was added separately, (A): 1-bromo-4-isocyanatobenzene (0.00084 mol, 0.18 g), (B): 1-chloro-4-isocyanatobenzene (0.00084 mol, 0.14 g), (C): 1-fluoro-isocyanatobenzene (0.00084 mol, 0.115 g), the mixture was stirred at 40–50 °C for 6 h, and then maintained stirring overnight. Under reduced pressure, half of the solvent was removed, and the residue was poured into ice. The precipitate was filtered off, and washed with ice-cold EtOH, to yield a product, and recrystallized from 70% EtOH.
N-(4-bromophenyl)-2-(2-((3-(trifluoromethyl)phenyl) amino) nicotinoyl) hydrazine-1-carboxamide (3A)
Light yellow powder, yield (50%), m.p = (232–234 ⁰C), Rf = 0.28. ATR-FTIR (ύ, cm-1): 3336, 3213 (NH) str of sec amide, 1665 (C = O) str. of amide (amide I band), 1594 (C = N) str, 1564, 1534, 1469 Ar (C = C) str, 1406 (C-F) str, 1332 (C-N) str, 694 (Ar- p- Br-substitution).
1HNMR (300MHz, DMSOd6, δ = ppm): 10.86 (s, 1H, NH), 10.58 (s,H, 1NH), 9.15 (s, 1H, NH), 8.42–8.21 (m, 3H, Ar-H), 7,88 (d, 1H, Ar-H), 7.52–6.99 (m, 6H, Ar-H).
13CNMR (75MHz, DMSOd6, δ = ppm): 158.66 (C = O), 157.14 (ArC = N), 151.38 (C = O), 150.00, 144.47, 141.30, 140.60, 135.99, 129.98, 125.45, 123.31 (CF3), 118.51, 117.02, 115.44, 115.22, 103.64.
MS (ESI) m/z: Calcd. for C20H15BrF3N5O2 [M+1]+ 494.04, found 494.2.
N-(4-chlorophenyl)-2-(2-((3-(trifluoromethyl)phenyl) amino) nicotinoyl) hydrazine-1-carboxamide (3B)
Dark yellow powder, yield (40%), m.p = (293–295 ⁰C), Rf = 0.28, ATR-FTIR (ύ, cm-1): 3336,3211 (NH) str. of sec amide, 1668 (C = O) str. of amide (amide I band), 1594 (C = N) str, 1531, 1469, 1445 Ar (C = C) str, 1406 (C-F) str1332 (C-N) str, 831 (Ar- p-Cl-substitution).
1 HNMR (300MHz, DMSOd6, δ = ppm): 10.69 (s, 1H, NH), 10.58 (s,H, NH), 9.15 (s,1H,NH), 8.42–8.18 (m, 3H, Ar-H), 7.88 (d, 1H, Ar-H), 7.55–7.46 (m, 4H, Ar-H), 7.34–7.31 (d, 2H, Ar-H), 6.99 (t, 1H, Ar-H).
13CNMR (75MHz, DMSOd6, δ = ppm): 167.67 (C = O), 155.58 (ArC = N), 153.77 (C = O), 150.84, 140.90, 138.47, 137.31, 131.36, 129.79, 128.47, 125.67, 122.82 (CF3), 120.25, 117.80, 115.07, 114.41, 111.02.
MS (ESI) m/z: Calcd. for C20H15ClF3N5O2 [M-2]+ 447.09, found 447.2
N-(4-fluorophenyl)-2-(2-((3-(trifluoromethyl) phenyl) amino) nicotinoyl) hydrazine-1-carboxamide (3C)
White powder, yield (47%), m.p = (210–213 ⁰C), Rf = 0.28. ATR-FTIR (ύ, cm-1): 3359,3193 (NH) str. of sec amide, 1662 (C = O) str. of amide (amide I band), 1594 (C = N) str, 1567, 1531, 1469Ar (C = C) str, 1409 (C-F) str, 1329 (C-N) str, 1108 (Ar- p-F-substitution).
1HNMR (300MHz, DMSOd6, δ = ppm): 9.81 (s, 1H, NH), 8.67 (s, 2H, 2NH), 7.48–7.09 (m, 11H, Ar-H).
13CNMR (75MHz, DMSOd6, δ = ppm): 152.29 (C = O), 152.26, 142.42, 138.46, 130.49, 124.09 (CF3), 123.09, 122.98, 119.29, 119.23, 117.16, 117.09, 116.41, 166.11, 115.35.
MS (ESI) m/z: Calcd. fo C20H15F4N5O2 [M]+ 433.12, found 433.9
Compound (2) (0.25 g, 0.00084 mol) was taken and dissolved in 25 mL of EtOH, then added separately (A): 4-isothiocyanatobenzene (0.00084 mol, 0.11 g), (B): 1-bromo-4-isothiocyanatobenzene (0.00084 mol, 0.18 g), (C): 1-chloro 4-isothiocyanato benzene (0.00084 mol, 0.15 g), (D): 1-isothiocyanato-4-nitrobenzene (0.00084 mol, 0.15 g) the reaction mixture was stirred in water bath at 40–50⁰C for 6 h , then kept stirring overnight. Under reduced pressure, half of the solvent was removed, and the residue was poured into ice. The precipitate was filtered off, and washed with ice-cold EtOH to produce a product, which recrystallized from 70% EtOH.
N-phenyl-2-(2-((3-(trifluoromethyl) phenyl) amino) nicotinoyl) hydrazine-1-carbothioamide (4A)
Yellow powder, yield (88%), m.p = (195–198 ⁰C), Rf = 0.55, ATR-FTIR (ύ, cm-1): 3243 (NH) str of sec amide, 3163 (NH) str of thioamide, 1668 (C = O) str. of amide (amide I band), 1614 (C = N) str, 1591 (NH) bend , 1525, 1492, 1463, Ar (C = C) str, 1394 (C-F) str, 1329 (C-N) str , 1251 (C = S) str.
1HNMR (300MHz, DMSOd6, δ = ppm): 10.86 (s, 2H, 2NH), 9.89 (s, 1H, NH), 9.75 (s, 1H, NH), 8.44–8.26 (m.3H, Ar-H), 7.86 (t, 1H, Ar-H), 7.54–7.33 (m, 6H, Ar-H), 7.18 (s, 1H, Ar-H), 7.00 (t, 1H, Ar-H).
13CNMR (75MHz, DMSOd6, δ = ppm): 181.12 (C = S), 162.30 (C = O), 154.02 (Ar = CN), 151.06, 140.82, 139.03, 137.88, 129.82, 129.28, 128.00, 126.04, 125.06, 122.98 (CF3), 117.89, 115.13, 114.26.
MS (ESI) m/z: Calcd. for C20H16F3N5OS [M]+ 431.10, found 431.9.
N-(4-bromophenyl)-2-(2-((3-(trifluoromethyl) phenyl) amino) nicotinoyl) hydrazine-1-carbothioamide (4B)
Yellow powder, yield (85%), m.p = (175–178 ⁰C), Rf = 0.58, ATR-FTIR (ύ, cm-1): 3309 (NH) str of sec amide, 3151 (NH) str of thioamide, 1644 (C = O)str. of amide (amide I band) , 1603 (C = N) str, 1549, 1531, 1492Ar (C = C) str, 1403 (C-F) str, 1326 (C-N) str, 1251 (C = S) str , 766 (Ar- p- Br-substitution).
1HNMR (300MHz, DMSOd6, δ = ppm): 10.87 (s, 1H, NH), 9.87 (s, 1H, NH), 8.45–8.26 (m, 3H, Ar-H), 7.85 (d, 1H, Ar-H), 7.54–7.30 (m, 6H, Ar-H), 7.01 (t, 1H, Ar-H).
13CNMR (75MHz, DMSOd6, δ = ppm): 181.57, 168.03, 162.79, 151.73, 141.27, 138.97, 138.42, 131.33, 130.33, 128.49, 126.10, 125.61, 123.54, 118.43, 115.66, 114.74, 110.39.
MS (ESI) calcd. for C20H15BrF3N5OS [M+1]+ 510.01, found 510.50
N-(4-chlorophenyl)-2-(2-((3-(trifluoromethyl)phenyl) amino) nicotinoyl) hydrazine-1-carbothioamide (4C)
Light yellow powder, yield (80%), m.p = (169–172 ⁰C), Rf = 0.58.ATR-FTIR (ύ, cm-1): 3312 (NH) str of sec amide, 3160 (NH) str. of thioamide, 1647 (C = O) str. of amide (amide I band), 1603 (C = N) str, 1549, 1495, 1445Ar (C = C) str, 1406 (C-F) str, 1329 (C-N) str, 1248 (C = S) str, 825 (Ar- p- Cl-substitution).
1HNMR (300MHz, DMSOd6, δ = ppm): 10.87 (s, 1H, NH), 9.86 (s, 2H, NH), 8.44 (d, 1H, Ar-H), 8.33–8.26 (m, 2H, Ar H), 7.83 (d, 1H, Ar-H), 7.54–7.33 (m, 6H, Ar-H), 7.02 (t, 1H, Ar-H).
13CNMR (75MHz, DMSOd6, δ = ppm): 169.94, 168.01, 162.78, 154.60, 151.75, 141.27, 138.54, 130.33, 129.84, 128.68, 128.41, 128.14, 126.10, 123.54, 118.42, 115.65, 114.74, 110.33.
MS (ESI) calcd. for C20H15ClF3N5OS [M+1]+ 466.06, found 466.00 .
N-(4-nitrophenyl)-2-(2-((3-(trifluoromethyl) phenyl) amino) nicotinoyl) hydrazine-1-carbothioamide (4D)
Yellow powder, yield (74%), m.p = (171–173 ⁰C), Rf = 0.56. ATR-FTIR (ύ, cm-1): 3309 (NH) str of sec amide, 3148 (NH) str. of thioamide, 1647 (C = O) str. of amide (amide I band), 1603 (C = N) str, 1561, 1531, 1445Ar (C = C) str, 1510, 1335 asym/sym. str. of NO2 group, respectively, 1412 (C-F) str , 1335 (C-N) str, 1251 (C = S) str.
1HNMR (300MHz, DMSOd6, δ = ppm): 10.97 (s, 1H, NH), 10.85 (s, 1H, NH), 10.21 (s, 1H, NH), 8.46 (s, 1H, Ar-H), 8.33–8.21 (m, 4H, Ar-H), 7.91–7.83 (m, 3H, Ar-H), 7.54 (d, 1H, Ar-H), 7.32 (d, 1H, Ar-H), 7.02 (t, 1H-Ar-H).
13CNMR (75MHz, DMSOd6, δ = ppm): 181.10 (C = S), 167.85 (C = O), 154.46 (ArC = N), 151.68, 145.82, 143.82 (C-NO2), 141.01, 138.16, 130.09, 125.87, 125.26, 123.88 (CF3), 123.37, 118.24, 115.52, 114.58, 110.01.
MS (ESI) Calcd. for C20H15F3N6O3S [M+1]+ 477.09, found 477.30.
The hydrazine carbothioamide compounds (4B, 4C, and 4D) (0.001 mol) were separately added to 2N NaOH (6.6 mL), stirred at RT for (15 min), when a clear yellow solution appeared, then it was refluxed for 3 h. Before acidifying with 2N HCl to pH = 3, the reaction mixture was cooled to room temperature. The resulting solid was filtered, and recrystallized from 70% EtOH, to afford the corresponding final compounds (5A,5B and 5C).
4-(4-bromophenyl)-5-(2-((3-(trifluoromethyl) phenyl) amino) pyridin-3-yl)-2,4-dihydro-3H-1,2,4-triazole-3-thione (5A)
Yellow powder, yield (65%), m.p = (200–203 ⁰C), Rf = 0.82. ATR-FTIR (ύ, cm-1): 3342 (NH) str. of sec amine, 3097 Ar (CH) str, 2758 (SH) str. 1677 (C = N) str, 1594, 1540, 1486Ar (C = C) str, 1329 (C-N) str, 1281 (C = S) str, 763 (Ar-p-Br-substitution).
1HNMR (300MHz, DMSOd6, δ = ppm): 11.07 (s, 1H, NH), 10.24 (s, 1H, NH), 8.39 (d, 1H, Ar-H) 8.09–7.92 (dd, 2H, Ar-H), 7.94(d,1H,Ar-H), 7.61–7.09 (dd, 8H, Ar-H).
13CNMR (75MHz,DMSOd6, δ = ppm): 159.12, 156.55, 151.32, 149.71 (C = N), 140.67, 137.70, 135.70, 131.88, 129.96, 129.78, 123.29 (CF3), 119.24, 118.44, 115.39, 115.19, 113.72, 103.85.
MS (ESI) Calcd. for C20H13BrF3N5S[M+1]+ 492.00, found 492.10.
4-(4-chlorophenyl)-5-(2-((3-(trifluoromethyl) phenyl) amino) pyridin-3-yl)-2,4-dihydro-3H-1,2,4-triazole-3-thione (5B)
White powder, yield (60%), m.p = (215–218 ⁰C), Rf = 0.73. ATR-FTIR (ύ, cm-1): 3318 (NH) str. of sec, amine, 3100 Ar (CH) str, 1650 (C = N) str, 1588, 1498, 1442Ar (C = C) str, 1385 (C-F) str, 1329 (C-N) str, 1251 (C = S) str, 763 (Ar-p-Cl-substitution).
1HNMR (300MHz, DMSOd6, δ = ppm): 14.26 (s, 1H, NH), 10.25 (s, 1H, NH), 8.76 (s, 1H, Ar-H), 8.26 (t, 1H, Ar-H), 7.73–7.23 (m, 8H, Ar-H), 6.92 (s, 1H, Ar-H).
13CNMR (75MHz, DMSOd6,δ = ppm): 167.93 (C = S), 152.33 (ArC = N), 149.81, 147.94, 141.19, 141.02, 133.53 (C-Cl), 132.70, 129.47, 129.20, 128.62, 122.56 (CF3), 117.37, 115.29, 114.91, 112.16, 108.38.
MS (ESI) Calcd. forC20H13Cl F3N2S [M]+ 447.05, found 447.90.
4-(4-nitrophenyl)-5-(2-((3-(trifluoromethyl) phenyl) amino) pyridin-3-yl)-2,4-dihydro-3H-1,2,4-triazole-3-thione (5C)
Dark yellow powder, yield (60%), m.p = (240–243 ⁰C), Rf = 0.79, ATR-FTIR (ύ, cm-1): 3431, 3330 (NH) str. of each sec, amine & cyclic thioamide, 2856 (SH) str, 1674 (C = N) str, 1632, 1591, 1457Ar (C = C) str, 1528, 1329 asym/sym. str. of NO2, respectively, 1415 (C-F) str, 1329 (C-N) str, 1248 (C = S) str.
1H-NMR (300MHz, DMSOd6,δ = ppm): 10.21 (s, 1H, NH), 8.47–8.30 (m, 4H, Ar-H), 8.13 (d, 1H, Ar-H) 7.95–7.85 (m, 3H, Ar-H), 7.38 (m, 1H, Ar-H), (dd, 7.12, 1H, Ar-H).
13CNMR (75MHz, DMSOd6, δ = ppm): 158.66 (ArC = N), 157.14, 151.38, 150.00, 144.47 (C-NO2), 141.30, 140.60, 135.99, 129.98, 125.45, 123.31, 117.02, 115.44, 115.39, 115.22, 103.64
MS (ESI) Calcd. for C20H13F3N6O2S [M+1]+ 459.08, found 459.30.
Hydrazine carboamide compound (3B) (0.001 mol, 0.25 g) was added to 2N NaOH (6.6 mL), stirred at RT for 15 min, a clear yellow solution appeared which was refluxed for 3 h. The reaction mixture was cooled at RT, until being acidified with 2N HCl, to obtain a pH of 3. The resulting solid was filtered and recrystallized from 70% EtOH to produce the corresponding final compound (6).
Yellow powder, yield (47%), m.p = (230–233 ⁰C), Rf = 0.77. ATR-FTIR (ύ,cm-1): 3333, (NH) str. of sec. amine, 3208 str of NH cyclic amide, 1665 (C = O) str, 1591 (C = N) str, 1564, 1531, 1445Ar (C = C) str, 1406 (C-F) str, 1329 (C-N) str, 766 (Ar-p-Cl-substitution).
1HNMR (300MHz, DMSOd6, δ = ppm): 10.69–10.58 (s, 2H, 2NH), 9.15 (s, 1H, OH (enolic form), 8.42–8.18 (m, 4H, Ar-H), 7.88 (d, 1H, Ar-H), 7.55–7.00 (m, 6H, Ar-H).
13CNMR (75MHz, DMSOd6, δ = ppm): 167.67, 155.58, 153.75, 150.84, 140.90, 138.45, 137.31, 131.42
(C-Cl), 129.80, 128.47, 125.69, 122.81 (CF3), 120.33, 120.26, 117.76, 115.06, 114.42.
MS (ESI) Calcd. for C20H13ClF3N5O[M+NH4]+ 449.80, found 449.90.
Synthesis of novel niflumic acid (NF) derivatives is depicted in scheme 1.
For the molecular docking process, the CDOCKER protocol was used. The receptor was kept rigid during the method, while the ligands were made flexible. Each molecule was allowed to create ten different interaction poses with the protein. When the best-fitting poses were identified, docking scores (-CDOCKER interaction energy) were noted. The protein data bank (https://www.rcsb.org) was used to identify molecular targets for the newly synthesized compounds (3A–6), compare them to other ligands, and determine the pharmacophoric functionality that may enable binding to the critical amino acid(s), at the target site. The hit compounds are assessed in practice against many active sites, and the findings are then used to select the proper protein for molecular docking.
Following the selection of a specific protein, some procedures were performed that provide an understanding of the molecular binding modes of the test compounds inside of the pockets of the proteins (VEGFR tyrosine kinase, and EGFR tyrosine kinase), by using MOE 19.0901 Software. The co-crystallized ligand was used to produce the binding sites within the crystal protein (PDB codes: 1YWN-4HJO) (https://www.rcsb.org). Water molecules were initially removed from the complex. The crystallographic disorders, and unfilled valence atoms were then corrected using protein report, utility, and clean protein options. Protein energy was minimized by applying MMFF94 force fields to it. Trying to apply a fixed atom constraint contributed to making the structure of the protein rigid. The essential amino acids of the protein are outlined and ready for docking. The 2D structures of the compounds tested were sketched in Chem-Bio Draw Ultra17.0, and saved in MDL-SD file format using MOE 19.0901 software. The saved file was opened, 3D structures protonated, and energy was kept to a minimum by using a .05 RMSD kcal/mol MMFF94 force field. The minimized structures were then ready for docking with the prepared ligand protocol.
Three human cell lines were used in the current study, the lung fibroblast normal cell line WI-38, and two cancer cell lines: A549 lung cancer cell line, and Hep G2 hepatocyte carcinoma cell line. WI-38 and Hep G2 cell lines were cultured in Eagle’s minimum essential medium (LONZA, Switzerland) supplemented with 10% fetal bovine serum (FBS; Gibco, USA), while A549 lung cancer cell line was cultured in Ham’s F-12K medium (Thermo Scientific, USA) supplemented with 10% FBS. Cells were passaged using trypsin-EDTA (Millipore-Merck, USA), and maintained at 37 °C in 5% CO2 and 95% air.
The MTT assay was used to evaluate the cytotoxicity of the newly synthesized NF derivatives against the different cell lines (
Flow cytometry was used to estimate the percentage of a cell population in the different phases of cell cycle (sub-G1, G1, S, and G2/M). Control and compound 4C-treated Hep G2 cancer cells (IC50, 48 h) were fixed, and stained with propidium iodide (PI). The fluorescence of the PI-DNA complex was detected using Epics XL-MCL Flow Cytometer (Beckman Coulter), and the Flowing software (version 2.5.1, Turku Centre for Biotechnology, Turku, Finland) was used to analyze the cell distribution at different stages of the cell cycle (
The Elabscience (USA) Annexin V-FITC / PI Cell Apoptosis Detection kit was used to identify viable, apoptotic, and necrotic cells. Control and compound 4C-treated Hep G2 cells (IC50 concentration, 48 h) were fixed, and stained with Annexin V-FITC, and propidium iodide (PI). Viable, apoptotic (early or late), or necrotic cells were distinguished by flow cytometry.
Total RNA from control and compound 4C-treated (IC50, 48 h) cells was extracted following manufacturer’s instructions (RNeasy mini kit, Qiagen, Germany). RNA was reverse transcribed to cDNA using the Revert Aid First Strand cDNA Synthesis kit (Thermo Scientific, USA), and assayed for p53, BAX, Bcl-2, and caspase-3 gene expression (mRNA level) by quantitative RT-PCR (qRT-PCR). GAPDH was used as the housekeeping (normalization) gene. 2 µL cDNA were mixed with 1 μL of forward primer, 1 μL reverse primer (Table
Sequence of qRT-PCR primers, forward (F) and reverse (R), used in the current study.
| Gene | Primer sequence | Reference |
|---|---|---|
| P53 | F: 5’- GCCCAACAACACCAGCTCCT -3’ R: 5’- CCTGGGCATCCTTGAGTTCC -3’ | ( |
| BAX | F: 5’- CCCGAGAGGTCTTTTTCCGAG -3’ R: 5’- CCAGCCCATGATGGTTCTGAT -3’ | ( |
| Bcl-2 | F: 5’- TTGTGGCCTTCTTTGAGTTCGGTG -3’ R: 5’- GGTGCCGGTTCAGGTACTCAGTCA -3’ | ( |
| Caspase-3 | F: 5’- ACATGGAAGCGAATCAATGGACTC -3’ R: 5’- AAGGACTCAAATTCTGTTGCCACC -3’ | ( |
| GAPDH | F: 5’- GACCCCTTCAT GACCTCAAC -3’ R: 5’- CTTCTCCATGGTGGT GAAGA -3’ |
The VEGFR2 Kinase Assay Kit and the EGFR kinase Assay Kit (BPS Bioscience, USA) were used to assess the inhibitory activities of compound 4C and compound 5B, respectively, using the Kinase-Glo MAX (Promega, USA), as a detection reagent. Eight different concentrations of each compound (1000, 300, 100, 30, 10, 3, 1, and 0.3 nM) were prepared, and tested following the manufacturer’s instructions. The concentration-percent remaining kinase activity (% inhibition) curve was used to calculate the concentration that caused 50% kinase activity inhibition (the effective concentration that inhibits 50% of kinase activity; EC50). The experiment was performed three times in triplicate.
Data presented in the current study are expressed as mean ± SEM of three independent experiments. GraphPad software (GraphPad Prism version 8.0, San Diego, CA, USA) was used to perform statistical analysis. Student’s t-test was used to determine significance between means, p value < 0.05 was considered significant.
All of these procedures are used to anticipate the proposed binding mode, affinity, and preferred orientation for each docking pose, and the binding scored energy (∆G) of the compounds examined against VEGFR tyrosine Kinase, and EGFR tyrosine Kinase (
Binding score energy (∆G; kcal/mol) of the tested compounds against VEGFR and EGFR tyrosine kinase target site PDB ID: 1YWN and 4HJO.
| Ligand | RMSD value (Å) | Docking score (kcal/mol) | Interactions | |
|---|---|---|---|---|
| H.B | pi-interactions | |||
| Crystal ligand (1YWN) | 1.36 | -7.10 | 5 | 15 |
| Compound 3A | 1.67 | -8.76 | 2 | 16 |
| Compound 3B | 1.87 | -7.87 | - | 13 |
| Compound 3C | 1.50 | -8.11 | 5 | 9 |
| Compound 4A | 1.41 | -7.33 | 5 | 8 |
| Compound 4B | 1.64 | -8.58 | 4 | 6 |
| Compound 4C | 1.09 | -8.18 | 4 | 10 |
| Compound 4D | 1.22 | -8.62 | 4 | 14 |
| Crystal ligand 4HJO (Erlotinib) | 1.39 | -7.95 | 1 | 5 |
| Compound 5A | 1.30 | -7.74 | 4 | 10 |
| Compound 5B | 1.03 | -7.78 | 4 | 9 |
| Compound 5C | 1.55 | -9.11 | 10 | 11 |
| Compound 6 | 1.34 | -8.17 | 4 | 9 |
The crystal ligand’s (analogue of sorafenib) binding mode exhibited an energy of -7.10 kcal/ mol against VEGFR tyrosine kinase. In which the 4-amino furo [2,3-d] pyrimidin-5-yl moiety formed eight pi-pi, and pi-alkyl interactions with Val846, Leu838, Leu1033, Phe916, Cys917, and Ala864. Additionally, binding with Glu183 and Cys917 by two H-bonds with a distance of 1.83 and 2.05 °A. The 4-chloro -3-(trifluoromethyl) phenyl) urea moiety formed seven pi-alkyl interactions with Val914, Cys1043, Val897, Ala864, Leu1017, Ile890, Leu887, and five H- bonds with Asp1044, Glu883, and Ile1042 (1.83, 1.87, 3.54, 1.95 and 3.47 °A). On the other hand, the 4-methoxy phenyl moiety formed a pi-alkyl interaction with Val846. (Fig.
The binding mode of the crystal ligand (erlotinib) displayed a binding’s energy of -7.95 kcal/ mol against EGFR tyrosine kinase. The quinazolin-4-amine ring established three pi-alkyl interactions with Leu694, Ala719, and Leu820. Furthermore, the amino group in the quinazoline ring interacted with Met769 by one H-bond with a distance of 2.10 °A. While the 3-ethynylphenyl moiety formed two pi-alkyl interactions with Val702, and Leu820. (Fig.
The candidate compound 3A’s binding mode exhibited an energy binding of -8.76 kcal/mol against VEGFR tyrosine kinase. The 3-(trifluoromethyl) phenyl) amino) nicotinoyl moiety, had thirteen pi-alkyl and pi-pi interactions with Ala864, Cys917, Phe916, Leu1033, Leu838, Val914, Lys866, Phe1045, Leu1047 and Val846, and interacted with Cys917 via two H- bonds at a distance of 2.18 and 3.18 °A, while the 4-bromophenyl hydrazine-1-carboxamide moiety produced three pi-alkyl interactions with Cys1022, Leu1017, and Ile890. In addition, there are two ionic interactions with Asp1044, and Glu883. (Fig.
Compound 5C showed an energy binding of -9.11 kcal/ mol against EGFR tyrosine kinase. The 3-(trifluoromethyl) phenyl) amino) pyridin-3-yl moiety formed five pi-sulfur and pi-alkyl interactions with Val702, Lys721, Leu764, Met742, and Ala719. Moreover, it interacted with Phe832, Cys751, and Arg752 by seven H- bonds (2.75, 2.93, 3.65, 4.91, 3.45, 3.03, and 3.25 °A). The 4-nitrophenyl-1,2,4-triazole-3-thione moiety produced six pi-alkyl interactions with Leu694, Leu820, Ala719, and Val702, and three H- bonds with Met769, Arg817, and Asp831 (2.09, 3.49, and 2.56 °A) (Fig.
A molecular similarity study was performed for eleven ligands that showed anticancer activities against VEGFR-2 tyrosine kinase, and EGFR tyrosine crystal ligands using the Discovery Studio software. The used molecular properties included the number of rotatable bonds, number of cyclic rings, number of aromatic rings, number of hydrogen bond donors (HBD), number of hydrogen bond acceptors (HBA), partition coefficient (Log p), molecular weight (M.Wt.), and molecular fractional polar surface area (MFPSA) (Fig.
The results of the molecular properties including partition coefficient (Log p), molecular weight (M.Wt.), number of hydrogen bond donors (HBD), number of hydrogen bond acceptors (HBA), the number of rotatable bonds, number of cyclic rings, number of aromatic rings, molecular fractional polar surface area (MFPSA), and minimum distance.
| Comp. | Log p | M. Wt | HBA | HBD | Rotatable bonds | Rings | Aromatic rings | MFPSA | Minimum Distance |
|---|---|---|---|---|---|---|---|---|---|
| 3A | 4.409 | 494.265 | 4 | 4 | 6 | 3 | 3 | 0.229 | 0.479711 |
| 3B | 4.325 | 449.814 | 4 | 4 | 6 | 3 | 3 | 0.231 | 0.405977 |
| 3C | 3.866 | 433.359 | 4 | 4 | 6 | 3 | 3 | 0.237 | 0.519793 |
| 4A | 5.155 | 431.434 | 4 | 4 | 8 | 3 | 3 | 0.273 | 0.925923 |
| 4B | 5.903 | 510.33 | 4 | 4 | 8 | 3 | 3 | 0.257 | 1.13235 |
| 4C | 5.819 | 465.879 | 4 | 4 | 8 | 3 | 3 | 0.259 | 1.01524 |
| 4D | 5.049 | 476.432 | 6 | 4 | 9 | 3 | 3 | 0.353 | 1.56193 |
| 5A | 6.307 | 492.315 | 4 | 2 | 5 | 4 | 3 | 0.209 | 1.23722 |
| 5B | 6.223 | 447.864 | 4 | 2 | 5 | 4 | 3 | 0.211 | 1.18748 |
| 5C | 5.453 | 458.416 | 6 | 2 | 6 | 4 | 3 | 0.313 | 1.37821 |
| 6 | 5.201 | 431.798 | 4 | 2 | 5 | 4 | 3 | 0.18 | 0.938916 |
| Crystal ligand (1YWN) | 5.499 | 537.465 | 5 | 3 | 6 | 5 | 5 | 0.228 | – |
| Erlotinib | 4.309 | 393.436 | 7 | 1 | 10 | 3 | 3 | 0.177 | – |
| Sorafenib | 4.175 | 464.825 | 4 | 3 | 6 | 3 | 3 | 0.212 | – |
The findings of the ADMET studies (absorption, distribution, metabolism, excretion, and toxicology), were measured using Biovia Discovery Studio 2019. They revealed that blood penetration levels of the brain-blood barrier (BBB) of all ligands ranged from medium to low, indicating a lower possibility for CNS side effects. Additionally, all ligands had low solubility levels. Furthermore, most the tested ligands showed good absorption levels and appeared to be non-inhibitors for cytochrome P450. Concerning hepatotoxicity, all ligands were predicted to be non-hepatotoxic, compared with sorafenib and erlotinib, which showed some levels of in silico hepatotoxicity. Finally, some ligands were predicted to bind plasma protein (PPB) by more than 90%. These findings indicate that all ligands have good pharmacokinetic properties, and accordingly, they were preferred for further investigations (Table
| Compound | BBB levela | Solubility levelb | Absorption levelc | Hepatotoxicity | CYP2D6 prediction | PPB predictione |
|---|---|---|---|---|---|---|
| 3a | 4 | 1 | 0 | False | False | True |
| 3b | 4 | 1 | 0 | False | False | True |
| 3c | 4 | 1 | 0 | False | False | True |
| 4a | 2 | 1 | 0 | False | False | True |
| 4b | 4 | 1 | 1 | False | False | True |
| 4c | 4 | 1 | 1 | False | False | True |
| 4d | 4 | 1 | 2 | False | False | True |
| Sorafenib | 4 | 1 | 0 | True | False | True |
| Crystal ligand (1YWN) | 4 | 1 | 1 | False | False | True |
| 5a | 4 | 0 | 2 | False | False | True |
| 5b | 4 | 0 | 2 | False | True | True |
| 5c | 4 | 0 | 2 | False | False | True |
| 6 | 1 | 1 | 0 | False | True | True |
| Erlotinib | 1 | 2 | 0 | True | False | True |
The most promising ligands (3A, 4D, and 5C) were chosen for DFT studies to investigate their electronic profiles. DFT goal is the quantitative understanding of material properties from the fundamental law of quantum mechanics. The Discovery studio software was utilized in this test. Crystal ligand (1 ywn), and Erlotinib were utilized, as reference molecules. The calculated DFT parameters include the total energy of the molecules, binding energy, energy of the highest occupied molecular orbital (HOMO), the energy of the lowest unoccupied molecular orbital (LUMO), and the magnitude of the dipole moment. The HOMO is coupled with an electron donor ability, while LUMO is linked to the acceptance of electrons. These orbitals describe the way the ligand will interact with other species. The gap energy helps to balance the chemical reactivity with the kinetic stability of a drug. Furthermore, the total dipole moment describes the ability of interaction of a chemical candidate with the surrounding environment. The results of DFT studies are summarized in (Table
| Comp. | Total Energy (kcal/mol) | Binding Energy (kcal/mol) | HOMO Energy (kcal/mol) | LUMO Energy (kcal/mol) | Dipole moment. Debye | Band Gap Energy (kcal/mol) |
|---|---|---|---|---|---|---|
| 3A | -4053.52 | -9.407 | -0.198 | -0.111 | 1.697 | 0.087 |
| 4C | -3684.32 | -9.965 | -0.2136 | -0.156 | 3.4869 | 0.057 |
| 4D | -2008.56 | -9.6656 | -0.2089 | -0.1430 | 3.4782 | 0.0659 |
| 5B | -1932.5 | -9.174 | -0.211 | -0.1531 | 0.7232 | 0.0579 |
| Crystal- Ligand (1YWN) | -1921.4 | -10.226 | -0.190 | -0.153 | 4.082 | 0.037 |
| Erlotinib (4HJO) | -1305.6 | -10.051 | -0.1882 | -0.092 | 2.323 | 0.0962 |
Compounds 3A, 4C, 4D, and VEGFR tyrosine kinase crystal ligand (1YWN), showed total energy values of -4053.52, -3684.32, -2008.56, and -1921.4 kcal/mol, respectively. Such findings revealed that compounds 3A and 4C possess the highest total energy, indicating the high chance for drug-receptor complex formation. Correspondingly, compound 4C had the highest dipole moment value of 3.486 (debye), referring to the high possibility of compound 4C interacting with the target receptor: VEGFR tyrosine kinase. In a similar manner, compound 4C had a low gap energy value of 0.0576 kcal/mol, indicating the high reactivity of such a compound to interact with the target macromolecule. Moreover, compounds 5B and Erlotinib had total energy values of -1932.5 and -1305.6; dipole moment values of 0.7232 and 2.323 (debye), and the gap energy value of 0.0579, and 0.0962 kcal/mol, respectively. That indicates that compound 5B has a high chance for drug-receptor complex formation with EGFR tyrosine kinase.
Molecular dynamics (MD) simulations were carried out to compare the binding stability of the tested compounds. After doing the molecular docking, ligand 4D showed more stability, binding by more hydrogen bonds than other ligands. An MD simulation has been done to confirm its stability, which revealed that ligand 4D showed a good RMSD value along of 100 ns MD, the target protein showed a RMSD value of 2.7⁰A, while the complex exhibited a RMSD value of 3.7⁰A. An acceptable range is around 4⁰A. This complex was shown to be stable in a 100 ns MD simulation (Fig.
The in vitro anti-proliferative effects of the 11 tested compounds (3A-6) were evaluated by the MTT assay (Suppl. material
In vitro anti-proliferative activities of the tested compounds against Hep G2 and A549 cancer cell lines. Data shown is the average IC50 values in µM of three independent experiments performed in triplicates.
| Compound | IC50/HepG2 | IC50/A549 |
|---|---|---|
| 3A | 9.68 | 8.56 |
| 3B | 23.71 | 27.83 |
| 3C | 16.06 | 21.05 |
| 4A | 19.52 | 23.13 |
| 4B | 8.19 | 8.59 |
| 4C | 4.62 | 10.01 |
| 4D | 11.65 | 19.52 |
| 5A | 26.09 | 14.80 |
| 5B | 7.10 | 5.24 |
| 5C | 43.91 | 45.08 |
| 6 | 18.69 | 12.27 |
Furthermore, the selectivity of compound 4C against cancer cells was assessed. The cytotoxicity of compound 4C was tested against the normal cell line WI-38 lung fibroblasts, and the IC50 calculated for this compound against WI-38 cells was 33.42 µM (Suppl. material
Control and 48 h compound 4C-treated (at the IC50 concentration) Hep G2 cells were stained with propidium iodide (PI), and the distribution (%) of cells in each phase of the cell cycle (Sub-G1, G1, S, and G2/M) was determined by flow cytometry (Fig.
Distribution of control and compound 4C-treated Hep G2 cells in the different phases of the cell cycle. Values are given as mean ± SEM. *p < 0.05, **p < 0.01, as compared to control cells.
| % Sub-G1 | % G1 | % S | % G2/M | |
|---|---|---|---|---|
| Control | 0.57 ± 0.30 | 58.84 ± 3.91 | 23.76 ± 2.90 | 16.83 ± 1.41 |
| Compound 4C-treated | 0.78 ± 0.13 | 31.78 ± 0.97** | 37.12 ± 1.31* | 30.32 ± 1.09** |
Since compound 4C (and the other compounds as well) caused cytotoxicity, we aimed to investigate if compound 4C caused cell killing by inducing apoptosis and/or necrosis. Control and treated Hep G2 cells were fixed, stained with PI and annexin V-FITC, and subjected to flow cytometry (Fig.
The cytotoxicity of compound 4C against Hep G2 hepatocyte carcinoma cells is attributed to apoptosis not necrosis. Values are given as mean ± SEM. ****p < 0.0001, as compared to control Hep G2 cells.
| % Viable | %Early apoptosis | % Late apoptosis | % Necrosis | |
|---|---|---|---|---|
| Control | 92.94 ± 1.44 | 6.17 ± 1.59 | 0.78 ± 0.17 | 0.11 ± 0.03 |
| Compound 4C treated | 46.59 ± 1.56 | 51.86 ± 1.69**** | 1.42 ± 0.20 | 0.13 ± 0.02 |
Cytotoxicity of compound 4C is attributed to apoptosis not necrosis. A) Hep G2 cells were treated with compound 4C (4.62 µM) for 48 h, harvested, stained with AnnexinV-FITC/propidium iodide (PI), and analyzed for apoptosis (early: bottom right corner negative PI/positive annexin V; late: top right corner positive PI/positive annexin V) versus necrosis (top left corner positive PI/negative annexin V) using flow cytometry, B) mRNA level analysis of p53, BAX, Bcl-2, and caspases-3 genes, normalized over GAPDH, in control and compound 4C-treated Hep G2 cells. Values are given as mean ± SEM of three independent experiments. *p < 0.05, **p < 0.01 as compared to control cells.
To confirm compound 4C induction of apoptosis, the mRNA levels of 4 apoptosis markers [p53, BAX (pro-apoptosis), Bcl-2 (anti-apoptosis), and caspase-3) were measured by qRT-PCR and the results are shown in Fig.
The results of the molecular docking studies presented in the current work classified the tested compounds into 2 groups, a group that has the potential to target vascular endothelial growth factor receptor (VEGFR; compounds 3A, 3B, 3C, 4A, 4B, 4C, and 4D), while the second group has the potential to target epithelial growth factor receptor (EGFR; 5A, 5B, 5C, and 6). Since compounds 4C and 5B achieved the lowest IC50 concentrations (Table
EC50 values (nM) of the tested compounds (4C and 5B) and standard compounds (Sorafenib and Erotinib) against EGFR or VEGFR Kinases. The experiment was performed three times.
| Compound | EGFR kinase | VEGFR-2 kinase |
|---|---|---|
| 4C | – | 77.23 |
| Sorafenib | – | 57.75 |
| 5B | 25.38 | – |
| Erlotinib | 9.91 | – |
The results shown in Table
A training set of 32 FDA approved VEGFR-2 tyrosine kinase inhibitors of known activity with IC50 values ranging from 0.035 to 1.2 M and a training set of 16 FDA approved EGFR tyrosine kinase inhibitors of known activity with IC50 values ranging from 0.5 to 37 M were collected from the Selleck hem library [https://www.selleckchem.com/subunits/VEGFR2_VEGFR_selpan.html]. The structures of these VEGFR-2 inhibitors were first drawn in Chem BioDraw Ultra 17 and saved in MDL-SD file format. The saved file was then opened by the Discovery Studio 2016 software. The ligand prepare protocol was used to prepare the structures, and the force fields (CHARMM and MMFF94) were used. The Grid Based Temp Model protocol was also used to generate a 3D QSAR model after the ligands were prepared. To determine the impact of substitutes on anticancer activity, quantitative structure-activity relationships (QSAR) were investigated. A Grid Based Temp Model (GBTM) analysis was used to generate models using a training set of 32 FDA-approved VEGFR-2 inhibitors, and a training set of 16 FDA-approved EGFR TK inhibitors. Data on anticancer activity was transformed from IC50 to PIC50 values (i.e., -logIC50), and used as dependent variables in QSAR studies. The generated QSAR model was depicted graphically by scattering plots of anticipated anticancer activity against VEGFR-2 versus experimental values for the training data set compounds, as shown in (Fig.
The validity of our QSAR model was proven by leave-one-out (LOO) internal validation (r 2 = 0.829). Cross-validation was also employed where q2, which is equivalent to r2 (pred), was 0.829. The increased value of q2 greater than 0.5 reveals the validity of a QSAR model (Suppl. material
The validity of our QSAR model was proven by leave-one-out (LOO) internal validation (r 2 = 0.937). Cross-validation was also employed where q 2, which is equivalent to r 2 (pred), was 0.937. The increased value of q2 greater than 0.5 reveals the validity of a QSAR model. Measuring the difference between the experimental and predicted activities of the training set gave an additional validation of the QSAR model. The activities predicted by the established QSAR model were very close to those tested experimentally, which showed that this model could be used to predict the anti-cancer effects of other effective analogues (Table
Comparison between the experimental IC50 and the predicted IC50 of few synthesized compounds against VEGFR-2 tyrosine kinase obtained by QSAR model.
| Compound | Experimental IC50 (nM) | Predicted IC50 (nM) |
|---|---|---|
| 3A | NA not tested | 87.53 |
| 3b | NA not tested | 72.33 |
| 3c | NA not tested | 61.65 |
| 4A | NA not tested | 51.99 |
| 4B | 99.91 | 72.02 |
| 4C | 77.23 | 69.12 |
| 4D | NA not tested | 64.56 |
Study of the Structure-Activity Relationships (SAR) of the new compounds revealed several common findings. The presence of an aryl or a heteroaryl fragment attached via the hydrophilic linker is crucial to the anticancer activity. Accordingly, compounds that have a hydrazine-1-carbothioamide moiety showed good activity, compared with those containing a hydrazine-1-carboxamide moiety (IC50 range = 8.59–23.13 µM, compared with 8.56–27.83 µM), respectively. According to the terminal hydrophobic moiety, compounds 3A, 3B, and 3C contain hydrazine-1-carboxamide, but are different in the terminal substitution at the hydrophobic part. The IC50 of the derivatives containing bromo (3A), and fluoro (3C) groups, was higher than that of derivatives containing chloro (3B) group. According to the derivatives that contain hydrazine-1-carbothioamide, compounds (4A, 4B, 4C, and 4D), chloro derivative (4C), had the highest IC50 compared with bromo (4B), nitro (4D), and unsubstituted (4A) aromatic derivatives, (Fig.
The SAR of the new compounds (5A, 5B, 5C, and 6) revealed several common findings. The presence of an aryl or a heteroaryl fragment attached via the hydrophilic linker is crucial to the anticancer activity. According to compounds (5A, 5B, 5C, and 6), chloro derivative (5B) is better than bromo (5A) derivative, and nitro derivative (5C), which indicates the activity is enhanced by increasing electro negativity (Fig.
A series of niflumic acid derivatives (3A–6) have been successfully synthesized, and their chemical structures were confirmed using FT-IR, 1H, and 13C-NMR, and MS. The molecular docking studies, and MTT assay for the tested compounds showed a high correlation between the expected results from the molecular modeling and the wet-lab biological evaluations, which indicated high selectivity against the VEGFR, and EGFR tyrosine kinase target sites. Additionally, in silico pre-ADMET study showed that all tested compounds have low CNS side effects, and a carcinogenicity score close to zero. The newly synthesized niflumic acid derivatives are potent anticancer agents which inhibit cell proliferation by inhibiting VEGFR tyrosine kinase or EGFR tyrosine kinase activity, which leads to cell cycle arrest, which in turn induces apoptosis, leading to cancer cell killing (Fig.
The authors declare that there is no conflict of interest.
The authors are grateful to the Department of Pharmaceutical Chemistry, College of Pharmacy, University of Bagdad, Iraq, for supporting the current work.
Figures S1, S2, Tables S1, S2
Data type: Doc file
Explanation note: Figure S1. The MTT assay results of the 11 tested compounds against Hep G2 hepatocyte carcinoma cells and compound 4C against WI-38 normal cell line (red square). Percent inhibition was calculated as OD treated/OD control × 100%. The concentration-percent inhibition curve was used to calculate the concentration which caused 50% growth inhibition (IC50) by linear interpolation from a semi-log plot of a dose-response curve. Figure S2. The MTT assay results of the 11 tested compounds against A549 lung cancer cell line. Percent inhibition was calculated as OD treated/OD control × 100%. The concentration-percent inhibition curve was used to calculate the concentration which caused 50% growth inhibition (IC50) by linear interpolation from a semi-log plot of a dose-response curve. Table S1. Validation of the 3D-QSAR model. Table S2. Comparison between the experimental and predicted anticancer activity of the training set compounds against VEGFR-2 obtained by QSAR model.