Research Article
Print
Research Article
Pentoxifylline ameliorates carbamazepine-induced hepatotoxicity via down expression of CYP3A4 and NF-kB gene expression in the rat: in vivo study
expand article infoFarah Rafie Mohammed‡, Yassir Mustafa Kamal Al Mulla Hummadi‡, Muthanna I. Al-Ezzi‡
‡ Mustansiriyah University, Baghdad, Iraq

Corresponding author: Farah Rafie Mohammed ( farah_rafia@uomustansiriyah.edu.iq )

Academic editor: Magdalena Kondeva-Burdina
© 2024 Farah Rafie Mohammed, Yassir Mustafa Kamal Al Mulla Hummadi, Muthanna I. Al-Ezzi.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation: Mohammed FR, Hummadi YMKAM, Al-Ezzi MI (2024) Pentoxifylline ameliorates carbamazepine-induced hepatotoxicity via down expression of CYP3A4 and NF-kB gene expression in the rat: in vivo study. Pharmacia 71: 1-11. https://doi.org/10.3897/pharmacia.71.e136976
Open Access

Abstract

Drug-induced liver injury (DILI) is a serious complication of many drugs, including carbamazepine; this study investigates the protective effect of pentoxifylline (PTX) against DILI induced by carbamazepine in rat models by attenuating CYP3A4 and NF-κB gene expression. Forty rats were divided into five groups: the control group received no treatment, the induction group received 50 mg/kg carbamazepine orally for 28 days, and three groups received PTX (100, 200, and 300 mg/kg) once daily for one hour before carbamazepine induction for 28 days. Then, the rats were euthanized, and blood and liver tissue were collected for biochemical, gene expression, and histopathology. PTX attenuates the carbamazepine-induced increased CYP3A4 and NF-κB gene expression, with the highest dose showing the best result. PTX also reduced aspartate aminotransferase, alanine aminotransferase, and malondialdehyde, while glutathione levels increased. In conclusion, PTX is highly efficacious in preventing and restoring the liver cells’ normal morphology and cellular function caused by carbamazepine hepatotoxicity. A possible mechanism of the PTC effect is hindering oxidative stress by scavenging free radicals and enhancing the body’s natural defense antioxidant system. Additionally, it exerts an anti-inflammatory impact by modulating NF-κB gene expression.

Keywords

carbamazepine, CYP3A4, gene expression, hepatotoxicity, NF-κB, pentoxifylline

Introduction

Adverse drug reactions (ADR) are a significant factor in causing liver damage, which may necessitate stopping the harmful medication, hospitalization, or, in severe cases, liver transplantation (Smith and Schmid 2006; Almazroo et al. 2017). Drug-induced liver injury (DILI) is the leading cause of acute liver failure (Ostapowicz et al. 2002). The function of the liver as the primary detoxifying organ for many drugs incidentally makes it the main target for these drugs to cause liver damage (David and Hamilton 2010; Katarey and Verma 2016; Alizzi et al. 2018; Saad et al. 2022).

DILI is commonly categorized as either intrinsic or idiosyncratic (Hosack et al. 2023). Intrinsic DILI usually occurs in a dose-dependent manner and follows a predictable pattern, with hepatotoxicity appearing within hours to days after exposure (EASL 2019). Drugs that cause intrinsic DILI are frequently lipophilic, allowing them to pass through the lipid bilayer of hepatocytes easily. They experience biomodification, transforming into reactive compounds that trigger oxidative stress and stimulate cellular signaling pathways, leading to mitochondrial dysfunction and disruptions in bile acid balance (EASL 2019). In contrast, idiosyncratic DILI usually has an unexpected progression. It can occur anytime from a few weeks to months after exposure to the drug (Chalasani et al. 2014), which may be associated with the adaptive immune system and specific human leukocyte antigen (Dara et al. 2016). DILI is a serious clinical consequence that arises during the treatment and diagnosis of several pathological conditions (Intesar Tarik et al. 2022). Several drugs are associated with DILI, such as antidepressants (González-Muñoz et al. 2020), teriflunomide (Wurzburger 2022), tigecycline (Shi et al. 2022), amiodarone (Fadhil et al. 2024), and potassium para-aminobenzoate (Plüß et al. 2022).

Oxidative stress (OS) occurs when reactive oxygen species (ROS) are produced as a by-product of regular metabolism. These ROS play important functions in cellular signaling and maintaining internal balance. Certain medicines that cause DILI can enhance the formation of ROS in multiple ways (Ye et al. 2018). Furthermore, in the development of DILI, the liver experiences an increase in mitochondrial H2O2 due to the depletion of GSH (glutathione) (Ye et al. 2018). Lipid peroxidation (LPO) may play a role in the cell death process in DILI. During LPO, the formation of lipid radicals results in the degradation of polyunsaturated fatty acids (PUFAs) in lipid membranes (Walgren et al. 2005). LPO can result in the abrupt and severe disruption of the membrane potential and ion gradients, ultimately resulting in necrotic cell death (Wendel et al. 1979). The occurrence of cell damage caused by LPO necessitates both the generation of oxidants and the dysfunction of antioxidant defense mechanisms (Jaeschke and Ramachandran 2018).

The clinical manifestation of DILI exhibits a wide range of severity and phenotypic expression, spanning from an asymptomatic increase of liver enzymes to the development of acute liver failure (ALF). Liver biopsy is typically not utilized to diagnose DILI. Instead, liver biochemistry is employed to determine the specific type of liver damage. DILI is usually defined as an increase in serum alanine aminotransferase (ALT) levels that are at least 5 times higher than the upper limit of normal (ULN), an increase in serum alkaline phosphatase (ALP) levels that are at least 2 times higher than the ULN, or a combination of ALT levels that are at least 3 times higher than the ULN along with a contemporary increase in total bilirubin (TBL) levels that are more than 2 times higher than the ULN (Benichou and Solal Celigny 1991; Andrade et al. 2019; EASL 2019).

Epileptic seizures are one of the most common chronic neurological disorders. Treated with antiepileptic medicines, like carbamazepine (CBZ); however, CBZ is usually associated with increased liver enzymes (Osuntokun et al. 2021b). CBZ is ionized in the intracellular fluid and shares structural similarities with tricyclic antidepressants. The most significant pathway for CBZ metabolism is the active metabolite CBZ-10,11-epoxide, produced by cytochrome P450 (CYP) isoenzymes, especially CYP3A4 and 3A5. This metabolite is assumed to contribute to the toxicity of CBZ (Kacirova et al. 2021).

CYP3A4 is crucial for the metabolism of CBZ and the production of CBZ 10–11 epoxide, the active CBZ metabolite. Epoxide hydrolase 1 (EPHX1), which encodes the microsomal epoxide hydrolase, is another significant CBZ metabolizer. The primary metabolizer of CBZ, EPHX1, converts CBZ 10,11-epoxide into the inactive, water-soluble metabolite CBZ 10,11-diol (Iannaccone et al. 2021). Other metabolites include 3-hydroxycarbamazepine (3OH-CBZ) and 2-hydroxycarbamazepine (2OH-CBZ). Myeloperoxidase (MPO) facilitates the secondary oxidation of CBZ-3-OH, which produces CBZ-3-OH free radicals. Oxidation of CBZ-2-OH leads to the formation of 2-OH iminostilbene. Additionally, it is believed that the conversion of CBZ to arene oxide plays a significant role in the hepatotoxicity caused by this drug (Jaramillo et al. 2014). The synthesis of these metabolites involves several CYP isoforms (Yip et al. 2021). Moreover, inducers and inhibitors of some CYP enzymes can alter the plasma levels of CBZ. Thus, complex interaction patterns may arise when CBZ is co-administered with other medications (Fuhr et al. 2021).

Pentoxifylline (PTX) is a methylxanthine medication that has been utilized in clinical practice for medical purposes such as peripheral arterial disorders(PAD) (Broderick et al. 2020). It also improves blood flow by opening blocked capillaries and microcirculation (Khairy et al. 2023). The anti-inflammatory property of PTX has been used to treat liver disorders by blocking phosphodiesterase-4 (PDE-4), increasing the intracellular concentration of cyclic adenosine monophosphate (cAMP); it also possesses an antioxidant property (Ahmed et al. 2012; Li et al. 2018). PTX was shown to protect the liver from chemically induced liver damage (Luo et al. 2015); some suggested this protection is associated with proinflammatory and anti-inflammatory cytokines, both strongly inhibited by PTX (Osuntokun et al. 2021b); however, the exact mechanism is still unknown.

This is the first study to examine the protective effects of PTX in DILI induced by CBZ, proposing that this effect is mediated via its activity on CYP3A4 and NF-κB gene expression in rat animal models. In addition to studying gene expression, the biochemical parameters for liver function enzymes, oxidative stress markers, and histopathological findings were examined to elucidate the molecular mechanisms for PTX activity.

Methods

Ethical approval

The Scientific Committee of Mustansiriyah University’s College of Pharmacy, Pharmacology, and Toxicology Department granted ethical approval for this study (approval number: 24, reference number: 102, date: 28 October 2023). Animal handling, experimental procedures, and euthanasia were carried out according to the guidelines for animal care of the National Institute of Health and the American Veterinarian Medical Association (AVMA) 2020 (Underwood and Anthony 2020). The authors complied with the ARRIVE 2.0 guidelines (Percie du Sert et al. 2020).

Study design and settings

This investigation, aimed at studying the effects of specific substances on male rats, carefully selected forty rats 8–11 weeks of age, weighing between 130 and 150 g. The rats were kept in large, comfortable cages, brought from the Iraqi Center for Cancer Research, and placed in the animal house at Mustansiriyah University, College of Pharmacy. They spent seven days in a regulated setting with an average temperature of 25 ± 1 °C, 40–50% humidity, and a 12-hour light/dark cycle. The rats had unrestricted access to food and water. The study was conducted at the animal house in the College of Pharmacy, Mustansiriyah University, between 28 October 2023 and 24 November 2023.

Five groups of eight rats per each were formed randomly using a complete block design: group 1 (normal control) received distilled water (DW) 10 mL/kg daily orally for 28 days (Bouhrim et al. 2021), group 2 (induction) received 50 mg/kg CBZ orally via gastric gavage for 28 days (Maheswari et al. 2014; Osuntokun et al. 2021a), group 3 (PTX100): received 100 mg/kg PTX orally via gastric gavage one hour before CBZ induction for 28 days (Kor et al. 2018), group 4 (PTX200): received 200 mg/kg PTX orally via gastric gavage one hour before CBZ induction for 28 days (Mohamed et al. 2014), and group 5 (PTX300): received 300 mg/kg PTX orally via gastric gavage one hour before CBZ induction for 28 days (Khairy et al. 2023), as illustrated in Fig. 1.

Figure 1. 

Flow chart of the study.

Pentoxifylline powder (Meryer, China) is freely soluble in saline; it was used as a freshly prepared aqueous solution (Hendawy 2017). Carbamazepine powder (Meryer, China) was dissolved in corn oil (Sasaki et al. 2016).

After the experimental phase of the study, all the animals were euthanized using anesthesia with a combination of ketamine and xylazine. Specifically, the rats were anesthetized intraperitoneally with 80 mg/kg of ketamine (Ketamine 10%, Alfasan Nederland BV, Holand) and 10 mg/kg of xylazine (XYL-M2, VMD® Livestock Pharma, Belgium). Once the animals were fully anesthetized, they passed away by exsanguination through cardiac puncture. This method was chosen as it allows for effective tissue harvest and preservation (Obaid and Fawzi 2024). Blood and tissue samples were collected for further analysis.

Special considerations to minimize the suffering and distress of animals

The animals in the study received treatment for any external injuries involving their skin using appropriate skin creams to prevent potential secondary infections. Additionally, a low dose of xylazine (3 mg/kg, IP) was administered when the animals exhibited signs of stress (Khafaji et al. 2024).

Sample collection

Blood samples were collected from the animals through heart puncture (Diehl et al. 2001; Hussein et al. 2024b). After blood was collected, the sample was spun at a speed of 5,000 revolutions per minute for 10 minutes to separate the serum. The serum was collected in 2 ml Eppendorf tubes and kept at a temperature of -20 until the analysis day. Following the animals’ sacrifice, a liver tissue sample was obtained. The tissues were then stored in a neutral buffered formalin solution (10%) and underwent histological inspection.

Assessment of biochemical analysis

The activities of colorimetric test kits measuring aspartate aminotransferase (AST) and ALT in serum samples were done using commercially available diagnostic kits (Linear Chemical, Spain). The enzyme-linked immunosorbent assay (ELISA) approach was used to measure the oxidative stress markers in the liver. As a result, malondialdehyde (MDA) (Linear Chemical, Spain), the end-product of lipid peroxidation, was used to quantify reactive species. Also, the antioxidant marker (GSH) (Linear Chemical, Spain) was measured using the ELISA method (Salahshoor et al. 2020).

Determination of mRNA expression of CYP3A4 and NF-KB in liver tissue

The real-time quantitative polymerase chain reaction (RT-PCR) method, which involves liver tissue isolation, total RNA extraction and purification, cDNA production, and RT-PCR procedures, was used to determine the gene expression levels of CYP3A4 and NF-κB in liver tissue. Data analysis was then conducted. β-actin was used as a housekeeping gene. Following a 28-day treatment with CBZ, the rats’ livers were removed, and TRIzol® was used to extract the RNA. After that, the RNA was reverse-transcribed to cDNA after being diluted with RNase-free water (Bai et al. 2021).

A mechanical homogenizer was used to homogenize the tissue, and centrifugation was performed. Then, the supernatant was mixed with 200 μL of chloroform and vigorously shaken for 30 seconds. Then, incubate for three minutes. Following a 15-minute centrifugation at 10,000 rpm and 4 °C, the mixture was separated into three layers: an upper containing the RNA. After pipetting and transferring into a fresh tube devoid of RNase, 600 μL of ethanol was added (to facilitate RNA isolation). The mixture was run through a spin column and centrifuged for one minute at 4 °C at 12,000 rpm; 500 μL of clean buffer (CB9) was added and centrifuged for one minute at 12,000 rpm to remove impurities from the RNA (this step was repeated twice). Subsequently, 500 μL of wash buffer (WB9) was added to remove contaminants, rotating twice at 12,000 rpm for one minute at 4 °C. Then, centrifuged for two minutes at 12,000 rpm, the column matrix was allowed to air dry. Then, 120 μL of RNase-free water was added (Hussein et al. 2024a).

Table 1 lists the primers created and the RNA primer mix preparation by adding the following(RNA template, forward primer, and reverse primer) and testing for annealing temperatures for this investigation.

Table 1.
Download as
CSV
XLSX

The primer sequence of genes used in this study and suppliers.

Gene Forward primer sequence(5ʹ→3ʹdirection) Reverse primer sequence(5ʹ→3ʹdirection) Supplier
β-actin CTATCGGCAATGAGCGGTTCC TGTGTTGGCATAGAGGTCTTTACG Alpha-DNA, Canada
NF–κB GTCATCAGGAAGAGGTTTGGCT TGATAAGCTTAGCCCTTGCAGC Alpha-DNA, Canada
CYP3A4 TCTGTGCAGAAGCATCGAGTG TGGGAGGTGCCTTATTGGG Alpha-DNA, Canada

Histopathological examination

The liver tissues were fixed in 10% neutral formalin overnight. The tissues were dehydrated in ethanol, cleared in xylol, and then embedded in paraffin blocks using standard procedures. Three µm-thick paraffin slices of the liver were cut using a microtome. Sections were stained with hematoxylin and eosin (H&E) (Hamouda et al. 2022).

Two independent pathologists who were unaware of the study groups examined the grading of the disease activity; numerical values were assigned to this semiquantitative score, as illustrated in Table 2 (Batts and Ludwig 1995).

Table 2.
Download as
CSV
XLSX

Grading of disease activity. #

Grading terminology Criteria
Semiquantitative Description Lymphocytic piecemeal necrosis Lobular inflammation and necrosis
0 Portal: inflammation only; no activity None None
1 Minimal Patchy Occasional spotty necrosis
2 Mild Involving some or all portal tracts Little hepatocellular damage
3 Moderate Involving all portal tracts With noticeable hepatocellular damage
4 Severe It may have bridging fibrosis With prominent diffuse hepatocellular damage

# The more severe lesion should be used to determine the grade when there is a discrepancy between both criteria.

Sample size calculation and animal randomization

The software program G.Power was employed to calculate the sample size (Faul et al. 2007; Charan and Kantharia 2013). Random numbers were employed to generate groups in an Excel spreadsheet. The rats were placed in labeled containers and assigned tail tags to minimize confusion (Festing 2006).

Statistical analysis

Descriptive and inferential statistics were performed using GraphPad Prism 10.3; the normality test (Anderson Darling test) was performed initially to determine the continuous variable’s adherence to a normal distribution. The parametric variable was analyzed using the ANOVA and post hoc Tukey tests. In contrast, the non-parametric variable was analyzed using the Kruskal-Wallis and post hoc Dunn tests. 0.05 was considered the level of significance for the current study.

Results

Effect of PTX on serum AST and ALT activity

Serum AST and ALT levels were significantly higher in the induction groups than in the control group and significantly lower in the treatment groups than in the induction group. PTX at 300 mg/kg dose showed the lowest AST and ALT levels compared to the other treatment groups, as illustrated in Fig. 2A, B.

Figure 2. 

Assessment of serum levels of biomarkers according to the study groups. A ALT B AST C MDA D GSH.

Effect of PTX on Serum MDA and GSH

Serum MDA level was significantly higher in the induction groups than in the control group and significantly lower in the treatment groups than in the induction group. PTX at a 300 mg/kg dose showed the lowest MDA level compared to the other treatment groups, as illustrated in Fig. 2C.

Serum GSH was significantly lower in the induction group than in the control group; PTX at a dose of 200 and 300 mg/kg showed significantly higher GSH than the induction group, as illustrated in Fig. 2D.

Effect of PTX on CYP3A4 and NF-KB gene expression in liver toxicity

CBZ treatment increases the expression of CYP3A4 and NF-κB gene expression compared to the control group; PTX at a dose of 300 mg/kg significantly reduces the gene expression of CYP3A4 compared to the induction group, as illustrated in Fig. 3A. PTX at doses of 100, 200, and 300 mg/kg significantly reduces the gene expression of NF-κB compared to the induction group, as illustrated in Fig. 3B.

Figure 3. 

Violin plot of the gene expression according to treatment groups. A CYP3A4 gene expression B NF-κB gene expression.

Histological changes

A liver histopathology examination was conducted to confirm the biochemical changes in the liver, as shown in Fig. 4. In the control group, the liver section shows a typical appearance of the portal vein, standard bile duct, and normal appearance of hepatocytes (Fig. 4A). The induction group shows massive dilation of the central vein, generalized swelling of hepatocytes, and several areas of multiple focal necrosis cell death and accumulation of mononuclear cells (Fig. 4B). PTX100 group shows a usual central vein, as indicated by an arrow. Additionally, hepatocytes have a slight zonal cellular enlargement without necrosis (Fig. 4C). The PTX200 group displays a usual central vein with minimal congestion and normal hepatocytes with slight sinusoidal congestion (Fig. 4D). PTX300 group, this portion of the liver displays the following features: the central vein appears normal, the hepatocytes also appear normal, and the sinusoids are indicated by an arrow (Fig. 4E).

Figure 4. 

Histopathological section of the liver. Liver slices were stained with hematoxylin and eosin for histological investigation of the effects of CBZ and PTX on the liver. A Control group B induction group C the PTX100 group D the PTX200 group E the PTX300 group. H&E stain at 100× and 400× power.

Comparison of histological scores among study groups

A comparison of histological scores among study groups is shown in Table 3. In most of the scores (portal area, lobar area, degenerative & necrosis, venous & sinusoidal congestion, proliferation of cholangiocytes, and infiltration of MNC (mononuclear cells), the induction group showed the highest median score compared to the other groups.

Table 3.
Download as
CSV
XLSX

Assessment of histological scores.

Characteristic Control group Induction group PTX100 PTX200 PTX300 p-value
Portal area
Median (IQR) 0 (0) B 4 (1) A 0 (1) B 0 (0) B 0 (1) B 0.001
Range 0–0 3–4 0–1 0–0 0–1
Lobar area
Median (IQR) 0 (0) B 3 (1) A 0 (1) B 0 (0) B 0 (1) B 0.001
Range 0–0 3–4 0–1 0–0 0–1
Degeneration & Necrosis
Median (IQR) 0 (0) C 4 (1) A 3 (1) B 0 (0) C 0 (1) C <0.001
Range 0–0 3–4 2–3 0–0 0–1
Venous & sinusoidal congestion
Median (IQR) 0 (1) C 3 (1) A 2 (0) B 1 (0) B 1 (1) B 0.001
Range 0–1 2–3 1–2 1–2 1–1
Portal or lobular Fibrosis
Median (IQR) 0 (0) B 0 (0) B 1 (1) A 0 (0) B 0 (0) B 0.011
Range 0–0 0–0 0–1 0–0 0–0
Proliferation of Cholangiocytes
Median (IQR) 0 (0) D 4 (0) A 2 (2) B 0 (0) D 1 (2) C <0.001
Range 0–0 3–4 1–3 0–1 0–2
Infiltration of MNCs
Median (IQR) 0 (0) B 3 (3) A 0 (0) B 0 (1) B 0 (1) B 0.001
Range 0–0 3–3 0–0 0–1 0–0

Kruskal-Wallis test was used, and Dunn’s post hoc was used for multiple comparison. The significance level was indicated with capital letters. There is no significant difference when two letters are similar; when they differ, there is. The letter A represents the greatest mean value, followed by B, C, D, and E. IQR: inter-quartile range, MNCs: mononuclear cells

PTX showed a dose-dependent reduction in the inflammatory scores in the portal and lobar areas, degenerative and necrosis, venous and sinusoidal congestion, proliferation of cholangiocytes, and infiltration of MNC, with the higher doses showing better reduction (in descending order 300, 200, and 100 mg).

Discussion

When selecting medications to treat epileptic seizures, the liver is still one of the essential organs that must be given extra thought. CBZ, first-line AEDs produce toxicity and raise liver enzymes (Osuntokun et al. 2021b). The liver’s integrity was assessed by measuring the liver enzymes, ALT and AST; the level of these enzymes in the group receiving CBZ in the current investigation was higher than in the other groups. Hepatic damage results in the leakage of liver enzymes into the bloodstream and raises their level in serum, indicating liver dysfunction (Salahshoor et al. 2020). These findings are consistent with other research (Kareem et al. 2022). All treatment groups showed significantly lower AST and ALT levels than the induction groups, indicating that PTX significantly dropped ALT and AST serum activity; this agrees with a previous study demonstrating that PTX treatment reduced hepatic damage (Ali et al. 2018).

This investigation showed that CBZ use increased the OS and decreased antioxidant enzyme activity. An imbalance between the oxidative and antioxidant systems was caused by long-term use of CBZ, which led to a significant increase in OS markers such as MDA and a reduction in GSH. In the present study, serum MDA levels were significantly higher in the induction group than in the control group, which is associated with the generation of ROS. A previous study showed that an excess of ROS causes cell death by apoptosis, which explains why apoptosis is higher after exposure to CBZ (Yan et al. 2021). In the present study, the MDA level decreased significantly in the PTX treatment groups compared to the induction group; this agrees with another study showing no enhancement in MDA plasma levels following PTX treatment in patients who experienced a recent cardiac event (Saeed et al. 2024).

Disruption of physiologically active proteins, DNA, or phospholipids produces free radicals, which generate hydroperoxides and endoperoxides. These compounds can further decompose to form reactive intermediates such as MDA, causing cell death or the inactivation of vital cellular processes (El-Mowafy et al. 2022).

The results of the present study show a decrease in GSH levels in the CBZ group compared to the control group, which is consistent with another study (Kareem et al. 2022); extended overproduction of free radicals and OS may be compensated by increased GSH activity (Khairy et al. 2023).

Treatment with PTX significantly increased GSH levels in the current study, supporting cell survival and preserving the body’s natural antioxidant defenses. The potential of PTX to upregulate the Nrf-2 transcription factor may account for its more substantial influence on GSH (Ali et al. 2018). Additionally, because of its actions in scavenging free radicals, PTX decreased MDA, contrary to the findings of another study, which revealed a rise in MDA levels and no enhancement in the reduction of GSH in ischemia/reperfusion (Demir and Inal-Erden 1998). ROS can alter signaling effectors, including enzymes and transcription factors like NF-κB, specifically affecting cell division, proliferation, and apoptosis, ultimately resulting in cell disruptions (El-Mowafy et al. 2022).

NF-kB is activated during or immediately before cell apoptosis (programmed cell death) under stimulatory conditions, suggesting that the activation of NF-κB is strongly linked to the inhibition of apoptosis (Serasanambati and Chilakapati 2016). The prototypical activators of the NF-κB pathway are comprised of tumor necrosis factor α (TNF-α). NF-κB can interfere with apoptotic signals at various levels. The first pathway in which the NF-κB interferes with apoptosis is by inducing transcription of a set of genes coding for anti-apoptotic proteins (c-FLIP), which is under NF-κB control; upon induction, c-FLIP associates with the TNF receptor to compete with and block caspase-8 activation and thereby inhibit apoptosis. The second pathway by which NF-κB interferes with the apoptotic pathway in the mitochondria is that NF-κB transcribes the genes coding for several anti-apoptotic proteins that act to prevent cytochrome-c release and the subsequent caspase-9 activation, thereby inhibiting apoptosis (Serasanambati and Chilakapati 2016).

PTX can reduce the morbidity and mortality brought on by liver toxicity by its anti-inflammatory properties (Ali et al. 2018). PTX down-regulates NF-κB activity by diminishing phosphorylation and degradation of inhibitory complex I-κBα, nuclear translocation, and DNA binding of NF-κB. It possesses strong anti-inflammatory effects as it downregulates TLR4 signaling in monocytes (Khan et al. 2022).

In the current investigation, NF-κB was significantly upregulated after 28 days of CBZ administration. While the administration of PTX significantly reduced the up-regulation of NF-κB, these findings align with another study (Ali et al. 2018). The protective effects of PTX against CBZ-DILI could be attributed at least partly to the anti-inflammatory effects that appear in their ability to inhibit NF-κB.

The treated group (100 mg/kg) showed a slight decline in CYP3A4 level, the same as the PTX-treated group (200 mg/kg). Still, the major decline significantly occurs with the PTX-treated group (300 mg/kg), which decreases the biotransformation of CBZ and damages the hepatocytes. CYP3A4 and CYP3A5, two human CYP3A enzymes, are considered the most significant for drug metabolism; both are highly prevalent in the liver and gut (Saiz-Rodríguez et al. 2020). CYP3A4 is implicated in the biotransformation of multiple medications and continues to be a key player in the metabolism of numerous drugs, such as CBZ. CBZ substantially induced CYP3A4 (Kang et al. 2008). In the present study, CYP3A4 in the induction group was significantly higher than in the PTX groups, particularly at 300 mg/kg. PTX shows a decrease in CYP3A4 gene expression level.These results disagree with another study that shows the induction of CYP3A reached a higher level after 14 days of CBZ administration, then significantly decreased after 28 days of CBZ (Yamashita et al. 2002).

Histological changes encompass cellular apoptosis and the development of fibrous formations, resulting in the contraction and concealment of hepatic cells. The hepatocytes of rats’ livers subjected to CBZ poisoning exhibited significant damage and necrotic changes, consistent with the investigation results (Ali et al. 2022). The animals treated with CBZ showed a variety of degenerative alterations in their hepatic parenchyma, as observed in histological findings. At the same time, PTX groups revealed a significant improvement in the liver. Furthermore, higher doses of PTX had a more significant impact on restoring the standard shape of hepatocytes. The results align with the findings (Hamouda et al. 2022).

Study limitations

Although animal models offer significant insights into human illnesses, they may not completely represent the intricate nature of male infertility in humans. The research did not employ clinical data obtained from human participants. Despite the encouraging results in the rat model, more investigation is required to ascertain the safety and effectiveness of pentoxifylline in humans.

Conclusions

Overall, the findings indicate that PTX is highly efficacious in preventing and restoring the liver cells’ normal morphology and cellular function caused by carbamazepine hepatotoxicity. A possible mechanism of the PTC effect is hindering oxidative stress by scavenging free radicals and enhancing the body’s natural defense antioxidant system. Additionally, it exerts an anti-inflammatory impact by modulating NF-κB gene expression.

Additional information

Conflict of interest

The authors have declared that no competing interests exist.

Ethical statements

The authors declared that no clinical trials were used in the present study.

The authors declared that no experiments on humans or human tissues were performed for the present study.

The authors declared that no informed consent was obtained from the humans, donors or donors’ representatives participating in the study.

Experiments on animals: The Scientific Committee of Mustansiriyah University’s College of Pharmacy, Pharmacology and Toxicology Department granted ethical approval for this study (approval number: 24, reference number: 102, date: 28 October 2023).

The authors declared that no commercially available immortalised human and animal cell lines were used in the present study.

The authors declared that no commercially available immortalised human and animal cell lines were used in the present study.

Funding

No funding was reported.

Author contributions

Conceptualization, investigation, and Manuscript preparation, Mohammed FR, Hummadi YMK, Al-Ezzi MI. Supervision, Hummadi YMK, Al-Ezzi MI. Statistical analysis and review of final results, Mohammed FR. Manuscript review and editing, Mohammed FR, Hummadi YMK, Al-Ezzi MI. All authors have read and agreed to the published version of the manuscript.

Author ORCIDs

Farah Rafie Mohammed https://orcid.org/0009-0005-0979-9669

Data availability

All of the data that support the findings of this study are available in the main text.

References

  • Ahmed AF, El-Maraghy NN, Abdel Ghaney RH, Elshazly SM (2012) Therapeutic effect of captopril, pentoxifylline, and cordyceps sinensis in pre-hepatic portal hypertensive rats. Saudi Journal of Gastroenterology 18: 182–187. https://doi.org/10.4103/1319-3767.96451
  • Ali AB, Younus N, Mukhtar S, Abrar H, Kazmi T, Faisal L (2022) Histomorphometric features of hepatic toxicity caused by carbamazepine and its amelioration with vitamin E. International Journal of Endorsing Health Science Research 10: 1–9. https://doi.org/10.29052/IJEHSR.v10.i1.2022.01-05
  • Ali FEM, Bakr AG, Abo-Youssef AM, Azouz AA, Hemeida RAM (2018) Targeting Keap-1/Nrf-2 pathway and cytoglobin as a potential protective mechanism of diosmin and pentoxifylline against cholestatic liver cirrhosis. Life Sciences 207: 50–60. https://doi.org/10.1016/j.lfs.2018.05.048
  • Alizzi FJ, Showman HAK, Fawzi HA (2018) Levonorgestrel-releasing intrauterine system in adenomyosis; predictors for response and clinical outcome. Asian Journal of Pharmaceutical and Clinical Research 11: 214–217. https://doi.org/10.22159/ajpcr.2018.v11i12.27109
  • Andrade RJ, Chalasani N, Björnsson ES, Suzuki A, Kullak-Ublick GA, Watkins PB, Devarbhavi H, Merz M, Lucena MI, Kaplowitz N, Aithal GP (2019) Drug-induced liver injury. Nature Reviews Disease Primers 5: 58. https://doi.org/10.1038/s41572-019-0105-0
  • Bai Z, Jia K, Chen G, Liao X, Cao Z, Zhao Y, Zhang C, Lu H (2021) Carbamazepine induces hepatotoxicity in zebrafish by inhibition of the Wnt/β-catenin signaling pathway. Environmental Pollution 276: 116688. https://doi.org/10.1016/j.envpol.2021.116688
  • Benichou C, Solal Celigny P (1991) Standardization of definitions and criteria for causality assessment of adverse drug reactions. Drug-induced blood cytopenias: report of an international consensus meeting. Nouvelle Revue Française d’hématologie (1978) 33: 257–262.
  • Bouhrim M, Bencheikh N, Imtara H, Daoudi NE, Mechchate H, Ouassou H, Kharchoufa L, Elachouri M, Mekhfi H, Ziyyat A, Legssyer A, Aziz M, Bnouham M (2021) Protective effect of Opuntia dillenii (Ker Gawl.) Haw. seed oil on gentamicin-induced nephrotoxicity: a biochemical and histological analysis. ScientificWorld Journal 2021: 2173012. https://doi.org/10.1155/2021/2173012
  • Chalasani NP, Hayashi PH, Bonkovsky HL, Navarro VJ, Lee WM, Fontana RJ (2014) ACG Clinical Guideline: the diagnosis and management of idiosyncratic drug-induced liver injury. The American Journal of Gastroenterology 109: 950–966 [quiz 967]. https://doi.org/10.1038/ajg.2014.131
  • Dara L, Liu ZX, Kaplowitz N (2016) Mechanisms of adaptation and progression in idiosyncratic drug induced liver injury, clinical implications. Liver International 36: 158–165. https://doi.org/10.1111/liv.12988
  • David S, Hamilton JP (2010) Drug-induced Liver Injury. US Gastroenterol Hepatol Rev 6: 73–80.
  • Diehl KH, Hull R, Morton D, Pfister R, Rabemampianina Y, Smith D, Vidal JM, van de Vorstenbosch C (2001) A good practice guide to the administration of substances and removal of blood, including routes and volumes. Journal of Applied Toxicology 21: 15–23. https://doi.org/10.1002/jat.727
  • El-Mowafy AM, Abdel-Aziz AA, Abdel-Dayem MA (2022) Novel protection by Omega-3-FAs (DHA or EPA) against carbamazepine’s liver-injury: differential suppression of oxidative-stress and inflammatory markers, and the influence on carbamazepine-clearance. Clinical Nutrition Open Science 42: 14–26. https://doi.org/10.1016/j.nutos.2022.01.006
  • Fadhil AFSa, Yasir Mustafa K, Huda Jaber W, Medhat I (2024) Hepatotoxic effects of an oral amiodarone in white albino rats: sub-acute biochemical, and histopathological assessments. Al Mustansiriyah Journal of Pharmaceutical Sciences 24: 293–298. https://doi.org/10.32947/ajps.v24i3.1058
  • Faul F, Erdfelder E, Lang AG, Buchner A (2007) G*Power 3: a flexible statistical power analysis program for the social, behavioral, and biomedical sciences. Behavior Research Methods 39: 175–191. https://doi.org/10.3758/BF03193146
  • Fuhr LM, Marok FZ, Hanke N, Selzer D, Lehr T (2021) Pharmacokinetics of the CYP3A4 and CYP2B6 inducer carbamazepine and its drug-drug interaction potential: a physiologically based pharmacokinetic modeling approach. Pharmaceutics 13(2): 270. https://doi.org/10.3390/pharmaceutics13020270
  • González-Muñoz M, Monserrat Villatoro J, Marín-Serrano E, Stewart S, Bardón Rivera B, Marín J, Martínez de Soto L, Seco Meseguer E, Ramírez E (2020) A case report of a drug-induced liver injury (DILI) caused by multiple antidepressants with causality established by the updated Roussel Uclaf causality assessment method (RUCAM) and in vitro testing. Clinical Case Reports 8: 3105–3109. https://doi.org/10.1002/ccr3.3348
  • Hamouda AO, Abdel-Hamed AR, Abo-Elmatty DM, Khedr NF, Ghattas MH (2022) Pentoxifylline and its association with kaempferol improve NASH-associated manifestation in mice through anti-apoptotic, anti-necroptotic, antioxidant, and anti-inflammatory mechanisms. European Review for Medical and Pharmacological Sciences 26: 8644–8659.
  • Hendawy N (2017) Pentoxifylline attenuates cytokine stress and Fas system in syngeneic liver proteins induced experimental autoimmune hepatitis. Biomedicine & Pharmacotherapy 92: 316–323. https://doi.org/10.1016/j.biopha.2017.05.084
  • Hussein ZA, Abu-Raghif AR, Fawzi HA (2024a) The mitigating effect of para-hydroxycinnamic acid in bleomycin-induced pulmonary fibrosis in mice through targeting oxidative, inflammatory and fibrotic pathways. Basic and Clinical Pharmacology and Toxicology 135: 23–42. https://doi.org/10.1111/bcpt.14018
  • Hussein ZA, Abu-Raghif AR, Tahseen NJ, Rashed KA, Shaker NS, Fawzi HA (2024b) Vinpocetine alleviated alveolar epithelial cells injury in experimental pulmonary fibrosis by targeting PPAR-γ/NLRP3/NF-κB and TGF-β1/Smad2/3 pathways. Scientific Reports 14: 11131. https://doi.org/10.1038/s41598-024-61269-y
  • Iannaccone T, Sellitto C, Manzo V, Colucci F, Giudice V, Stefanelli B, Iuliano A, Corrivetti G, Filippelli A (2021) Pharmacogenetics of Carbamazepine and Valproate: Focus on Polymorphisms of Drug Metabolizing Enzymes and Transporters. Pharmaceuticals (Basel) 14(3): 204. https://doi.org/10.3390/ph14030204
  • Intesar Tarik N, Nadia Hameed M, Zainab Khalid A (2022) Antioxidative effect of metformin on valproic acid induced hepatoxicity in male rats. Al Mustansiriyah Journal of Pharmaceutical Sciences 22: 17–23. https://doi.org/10.32947/ajps.v22i3.885
  • Jaeschke H, Ramachandran A (2018) Oxidant Stress and Lipid Peroxidation in Acetaminophen Hepatotoxicity. React Oxygen Species (Apex) 5: 145–158. https://doi.org/10.20455/ros.2018.835
  • Jaramillo NM, Galindo IF, Vázquez AO, Cook HJ, A LL, López ML (2014) Pharmacogenetic potential biomarkers for carbamazepine adverse drug reactions and clinical response. Drug Metabolism and Drug Interactions 29: 67–79. https://doi.org/10.1515/dmdi-2013-0046
  • Kacirova I, Grundmann M, Brozmanova H (2021) Therapeutic monitoring of carbamazepine and its active metabolite during the 1st postnatal month: Influence of drug interactions. Biomedicine & Pharmacotherapy 137: 111412. https://doi.org/10.1016/j.biopha.2021.111412
  • Kang P, Liao M, Wester MR, Leeder JS, Pearce RE, Correia MA (2008) CYP3A4-Mediated carbamazepine (CBZ) metabolism: formation of a covalent CBZ-CYP3A4 adduct and alteration of the enzyme kinetic profile. Drug Metabolism and Disposition 36: 490–499. https://doi.org/10.1124/dmd.107.016501
  • Kareem DA, Sadoon AH, Majeed MF, Abbas BA (2022) Histological and enzymatic response of carbamazepine-induced liver injury as A biomarker in male mice. Iranian Journal of War and Public Health 14: 367–375.
  • Khafaji AW, Al-Zubaidy AA, Farhood IG, Fawzi HA (2024) Effects of topical isoxsuprine ointment on imiquimod-induced psoriasiform skin inflammation in mice. Naunyn-Schmiedeberg’s Archives of Pharmacology. https://doi.org/10.1007/s00210-024-03359-2
  • Khan AKA, Afzal AAA, Chaudhry ZACZA, Rafique SRS (2022) Efficacy of Melatonin and Pentoxifylline combination therapy in treatment of endotoxin induced hepatic dysfunction in white albino mice. Journal of Rawalpindi Medical College 26. https://doi.org/10.37939/jrmc.v26i1.1597
  • Kor A, Shahroozian E, Ahmadi-Hamedani M, Naeimi S (2018) The modulatory effects of Pentoxifylline in biochemical changes induced by 17α-ethinyl estradiol in the rat model. Iranian Journal of Toxicology 12: 5–9. https://doi.org/10.32598/IJT.12.4.391.2
  • Luo M, Dong L, Li J, Wang Y, Shang B (2015) Protective effects of pentoxifylline on acute liver injury induced by thioacetamide in rats. International Journal of Clinical and Experimental Pathology 8: 8990–8996.
  • Maheswari E, Saraswathy GR, Santhranii T (2014) Hepatoprotective and antioxidant activity of N-acetyl cysteine in carbamazepine-administered rats. Indian Journal of Pharmacology 46: 211–215. https://doi.org/10.4103/0253-7613.129321
  • Mohamed DI, Elmelegy AAsM, El-Aziz LFA, kawy HSA, AbdEl-Samad AA, El-Kharashi OA (2014) Hepatoprotective effects of early pentoxifylline administration on hepatic injury induced by concanavalin A in rat. Canadian Journal of Physiology and Pharmacology 92: 490–497. https://doi.org/10.1139/cjpp-2014-0085
  • Ostapowicz G, Fontana RJ, Schiødt FV, Larson A, Davern TJ, Han SH, McCashland TM, Shakil AO, Hay JE, Hynan L, Crippin JS, Blei AT, Samuel G, Reisch J, Lee WM (2002) Results of a prospective study of acute liver failure at 17 tertiary care centers in the United States. Annals of Internal Medicine 137: 947–954. https://doi.org/10.7326/0003-4819-137-12-200212170-00007
  • Osuntokun O, Oladokun O, Adedokun K, Atere T, Olayiwola G, Ayoka A (2021a) Hepato-toxicological and lipid profile of male Wistar rats following chronic carbamazepine, gabapentin, and carbamazepine-gabapentin adjunctive treatment. Research Journal of Health Sciences 9: 289–298. https://doi.org/10.4314/rejhs.v9i3.10
  • Osuntokun OS, Babatunde AA, Olayiwola G, Atere TG, Oladokun OO, Adedokun KI (2021b) Assessment of the biomarkers of hepatotoxicity following carbamazepine, levetiracetam, and carbamazepine-levetiracetam adjunctive treatment in male Wistar rats. Toxicology Reports 8: 592–598. https://doi.org/10.1016/j.toxrep.2021.03.008
  • Percie du Sert N, Ahluwalia A, Alam S, Avey MT, Baker M, Browne WJ, Clark A, Cuthill IC, Dirnagl U, Emerson M, Garner P, Holgate ST, Howells DW, Hurst V, Karp NA, Lazic SE, Lidster K, MacCallum CJ, Macleod M, Pearl EJ, Petersen OH, Rawle F, Reynolds P, Rooney K, Sena ES, Silberberg SD, Steckler T, Würbel H (2020) Reporting animal research: Explanation and elaboration for the ARRIVE guidelines 2.0. PLOS Biology 18: e3000411. https://doi.org/10.1371/journal.pbio.3000411
  • Plüß M, Tampe D, Schwörer H, Bremer SCB, Tampe B (2022) Case report: Kinetics of human leukocyte antigen receptor HLA-DR during liver injury induced by potassium para-aminobenzoate as assessed for causality using the updated RUCAM. Frontiers in Pharmacology 13: 966910. https://doi.org/10.3389/fphar.2022.966910
  • Saad HS, Yassir Mustafa K, Huda Jaber W (2022) Astaxanthin effect on apoptotic biomarkers in methotrexate-induced liver injury. Al Mustansiriyah Journal of Pharmaceutical Sciences 22: 43–50. https://doi.org/10.32947/ajps.v22i3.888
  • Saeed A, Farouk MM, Sabri NA, Saleh MA, Ahmed MA (2024) Effect of pentoxifylline on endothelial dysfunction, oxidative stress and inflammatory markers in STEMI patients. Future Science OA 10: Fso967. https://doi.org/10.2144/fsoa-2023-0266
  • Saiz-Rodríguez M, Almenara S, Navares-Gómez M, Ochoa D, Román M, Zubiaur P, Koller D, Santos M, Mejía G, Borobia AM, Rodríguez-Antona C, Abad-Santos F (2020) Effect of the most relevant CYP3A4 and CYP3A5 polymorphisms on the pharmacokinetic parameters of 10 CYP3A substrates. Biomedicines 8(4): 94. https://doi.org/10.3390/biomedicines8040094
  • Salahshoor MR, Jalili C, Abdolmaleki A, Roshankhah S (2020) Pentoxifylline modulation hepatotoxicity and apoptosis induced by nitrosamine in rats. Biomedical and Biotechnology Research Journal (BBRJ) 4: 251–258. https://doi.org/10.4103/bbrj.bbrj_54_20
  • Sasaki E, Iida A, Oda S, Tsuneyama K, Fukami T, Nakajima M, Yokoi T (2016) Pathogenetic analyses of carbamazepine-induced liver injury in F344 rats focused on immune- and inflammation-related factors. Experimental and Toxicologic Pathology 68: 27–38. https://doi.org/10.1016/j.etp.2015.09.004
  • Shi X, Lao D, Xu Q, Li X, Lv Q (2022) A case report of drug-induced liver injury after tigecycline administration: histopathological evidence and a probable causality grading as assessed by the updated RUCAM diagnostic scale. BMC Infectious Diseases 22: 368. https://doi.org/10.1186/s12879-022-07258-w
  • Smith DA, Schmid EF (2006) Drug withdrawals and the lessons within. Current Opinion in Drug Discovery & Development 9: 38–46.
  • Underwood W, Anthony R (2020) AVMA guidelines for the euthanasia of animals: 2020 edition, 2020–2021.
  • Wurzburger R (2022) A case of delayed hepatic injury associated with teriflunomide use as assessed for causality using the updated RUCAM. Case Reports in Hepatology 2022: 6331923. https://doi.org/10.1155/2022/6331923
  • Yamashita H, Kazawa T, Minatogawa Y, Ebisawa T, Yamauchi T (2002) Time-course of hepatic cytochrome p450 subfamily induction by chronic carbamazepine treatment in rats. The International Journal of Neuropsychopharmacology 5: 47–52. https://doi.org/10.1017/S1461145701002747
  • Yan S, Chen R, Wang M, Zha J (2021) Carbamazepine at environmentally relevant concentrations caused DNA damage and apoptosis in the liver of Chinese rare minnows (Gobiocypris rarus) by the Ras/Raf/ERK/p53 signaling pathway. Environmental Pollution 270: 116245. https://doi.org/10.1016/j.envpol.2020.116245
  • Ye H, Nelson LJ, Gómez Del Moral M, Martínez-Naves E, Cubero FJ (2018) Dissecting the molecular pathophysiology of drug-induced liver injury. World Journal of Gastroenterology 24: 1373–1385. https://doi.org/10.3748/wjg.v24.i13.1373
  • Yip VLM, Pertinez H, Meng X, Maggs JL, Carr DF, Park BK, Marson AG, Pirmohamed M (2021) Evaluation of clinical and genetic factors in the population pharmacokinetics of carbamazepine. British Journal of Clinical Pharmacology 87: 2572–2588. https://doi.org/10.1111/bcp.14667
login to comment