2-(5-bromo-1H-indole-2-carbonyl)-N-phenyl hydrazine-1-carbothioamide (2-NPHC) was obtained from the Department of Pharmaceutical Chemistry / College of Pharmacy / University of Baghdad, Iraq. Hassan et al. previously mentioned the compound´s chemical synthesis and characterization (Hassan et al. 2023).

The 1,1-diphenyl-2-picrylhydrazyl (DPPH), aprotinin, amphotericin B, aminocaproic acid, fibrinogen, L-glutamate, thrombin, and serum-free medium M199 solution were all purchased from (Sigma Aldrich, USA). Gentamicin 80 mg vial (Hikma Pharm., Gordan). Dimethyl sulfoxide (DMSO) (Romil, UK). MTT 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (Intron Biotech, Korea). RT-qPCR primers (Macrogen, Korea). TRIzol reagent (Thermo Fisher Scientific, USA).

The Human umbilical vein endothelial (HUVECs) cells and colon cancer cell line (HCT116) were obtained from the American Type Culture Collection. Cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM) with 10% (v/v) fetal bovine serum (FBS) and a mixture of antibiotics (penicillin, streptomycin, amphotericin B) under normal conditions (5% CO₂, 37 °C, 95% humidity). The cells were distributed into six-well plates at roughly 6 × 10⁴ cells/mL density. They were then incubated for two to three days to facilitate cell growth and achieve a confluency level of approximately 70%–80% (Unterleuthner et al. 2020).

The antiangiogenic activity of the test indole derivative was evaluated using the ex vivo rat aorta ring (RAR) assay and the in vivo chick chorioallantois membrane (CAM) assay. To elucidate the most probable mechanism of action of its antiangiogenic activity, the DPPH assay was performed to explore the ability of the test agent at free radical scavenging, MTT assay on HUVEC, as well as its ability to reduce the expression of the VEGF gene in HCT116.

The investigation was carried out in the tissue culture laboratory of the Pharmacology Department at the College of Medicine, Al-Nahrain University. The project commenced in August 2023 and was completed in March 2024. The studies were carried out after the approval of the Ethics Committee of the College of Medicine – Al-Nahrain University (approval number: UNCOMIRB202405015, date: 22 August 2023).

The rats were obtained from the animal house in the College of Medicine, Al-Nahrain University. They were kept in a hygienic environment at 23 ± 2 °C and a humidity level of approximately 45%. They were exposed to a twelve-hour cycle of light and darkness and given one week to adapt to the new habitat. During this time, they had unrestricted access to water and food.

Eight female Sprague Dawley rats, aged twelve to fourteen weeks, were given intraperitoneal anesthesia with a dosage of 80 mg/kg of ketamine and 10 mg/kg of xylazine. After being fully anesthetized, the rats were euthanized by puncturing their hearts (Pierozan et al. 2017; Underwood and Anthony 2020). The thoracic aorta is dissected using a microscope, washed with serum-free medium M199, cleared of surrounding fibro adipose material and remaining blood clots, and cut into thin rings measuring 1 mm thick. The experiment utilized a 48-well tissue culture plate. Each well was supplemented with 300 µl of fibrinogen (3 mg/ml) and aprotinin (5 mg/ml) in serum-free media (M199). Subsequently, ring tissues were positioned in the center of each well. Each well was supplemented with 10 μl of thrombin, produced at a concentration of 50 NIH U/mL in a solution of 0.15 M NaCl. The tissue culture was then kept in a humidified 5% CO₂ incubator (Lab Tech, Korea) at 37 °C for 30 minutes to allow for solidification and the creation of a fibrin gel. Next, 300 µl of medium M199, which was well-received, was supplemented with 0.1% E-aminocaproic acid, 1% L-glutamine, and 0.6% gentamycin. 2-NPHC was dissolved in 1% DMSO to create a stock solution with a concentration of 0.1% (10 mg of the drug in 1 ml of DMSO). This stock solution was then diluted in M199 medium to create a series of dilutions with the following concentrations: 100, 50, 25, 12.5, and 6.25 μg/ml. Every concentration was conducted in three replicates (Brown et al. 1996).

The culture plates were incubated in a humidified incubator at 37 °C with 5% CO₂ for five days. The uppermost layer of the medium was substituted with a new medium on the fourth day. Tissue rings exposed to only 1% DMSO are classified as negative control. The vessel growth inhibition was evaluated by calculating the average percentage of inhibition compared to the negative control (Nicosia 2009). On the sixth day of the operation, the quantification was performed manually using a 40× magnification inverted microscope (Optika, Italy), a camera, and specialized software.

Fourteen fertilized chicken eggs were acquired from a hatchery in AL-Taji/Baghdad, Iraq. The specimens were decontaminated using a solution of 70% ethanol alcohol and Povidone iodine 10%. Subsequently, they were placed in an incubator at 37 °C for approximately 72 hours, with a relative humidity of 60%. Following 72 hours of incubation, a small hole was created in the shell. Using a 2-ml syringe with a 21G needle, 2 ml of albumin was extracted. This process facilitates the separation of the CAM from the shell, allowing for a clearer observation of the formed CAM. Subsequently, the hole was closed. The eggs were horizontally incubated for an additional 24 hours.

Subsequently, a precision drill bit was employed to create a square-shaped opening (with a diameter of approximately 3–4 cm) in the shell. The square section of the shell was then extracted using pointed forceps. The resulting square opening was covered with sterile surgical adhesive tape. The drug under investigation, 2-NPHC, was produced at a concentration of 10 mg/ml (the final dose in each disc was 100 μg). It was then applied onto filter paper discs and allowed to dry before being transferred to the CAM. The embryos were incubated for 72 hours at 37 °C. Finally, the area of inhibition was captured and quantified. The entire treatment was carried out in a sterile environment (Marchesan et al. 1998).

The responses were categorized into three grades: + (3–6 mm), ++ (6–9 mm), and +++ (> 10 mm). The size of the zone of inhibition was measured using an image analyzer (BIOCOM Visiolab-TM 2000) (Murray 2008).

The DPPH technique was employed to test the free radical scavenging activity of 2-NPHC. 100 µl of the tested substance at concentrations of 500, 250, 125, 62.5, 31.25, and 15.625 µg were mixed with 200 µl of 0.1 mM DPPH dissolved in methanol. The mixture was then incubated for 30 minutes. The experiment used 96 well plates, with each concentration tested in triplicate. Subsequently, the absorbance was measured at 517 nm using an ELISA reader (Human^®, USA). The negative control consisted of 100 µl of methanol and 200 µl of DPPH (Blois 1958).

The MTT assay, based on the Mosmann method (Mosmann 1983), was employed to determine the proliferation ability of the cell line. All those cells were located within passages four to seven. The cells were subsequently exposed to a series of concentrations (400, 200, 100, 50, 25) µg/ml of the substances for forty-eight hours. The MTT was made by adding a 5 mg/ml concentration in PBS (phosphate buffer saline). A volume of 20 µl of MTT was added to each well, and the plates were placed in an incubator at a temperature of 37 °C, with a CO₂ concentration of 5%, for four hours. The plates were subsequently withdrawn from the incubator, and the supernatant layer was extracted. DMSO, in a volume of 200 µl, was added to each well. Next, the plates were forcefully shaken for one minute at room temperature to dissolve the blue crystals completely. An ELISA reader was utilized to measure the absorbance at a wavelength of 570 nm. The absorbance of the cell culture in the control media was considered to indicate 100% vitality. The vitality of treated cells was assessed by comparing it to the untreated control, expressed as a percentage. Each concentration was tested four times, and the experiment was repeated twice. The cell density in each well is 1 × 10⁴ cells.

The HCT116 cell line was individually subjected to two distinct doses of the test substance, namely 400 μg/ml (considered high) and 100 µg/ml (considered low), for 12 hours (based on the cytotoxicity analysis from the MTT assay, the serial concentration started at 400 µg/ml and ended at 25 µg/ml. We concluded that 400 µg/ml is preferably selected as the highest concentration for gene expression analysis, and 100 µg/ml was selected as the low concentration based on the RAR and CAM assays as the dose that gave visible angiogenic activity). Every group was replicated three times. After the incubation, the plates were removed and examined for any changes in shape or structure using an inverted microscope. The media was eliminated, and the cells were collected and kept in TriZol® reagent for gene expression evaluation. The gene that was specifically focused on in this experiment was the VEGF gene (Adams 2020). VEGF gene (GAGATGAGCTTCCTACAGCAC, and TCACCGCCTCGGCTTGTCACAT; forward and reverse primer), and for GAPDH gene (TGCCACCCAGAAGACTGTGG, and TTCAGCTCAGGGATGACCTT forward and reverse primer).

The RNA was extracted from the cell samples following the TRIzol® Reagent technique (Thermo Scientific, USA). The concentration of extracted RNA was determined using a Quantus Fluorometer (Promega, USA). The SYBR Green kit and the one-step real-time qPCR analysis equipment (BioMolecular equipment, Australia) were used to quantify the total mRNA expression. This was done to evaluate the relative mRNA expression of VEGF in the HCT116 cell line. The results were standardized using the housekeeping gene (GAPDH) with the delta-delta Cycle Threshold (DDCT) approach. Analysis of data was done based on the relative quantitation approach, which is the ratio between the RG (reference gene GAPDH) and GOI (gene of interest) and is represented by the (2^-ΔΔCT method) (Chomczynski and Sacchi 1987).

The results were reported as the mean ± standard deviation (SD). The CAM assay and gene expression findings were analyzed using one-way ANOVA and declared statistically significant at a significance level of P < 0.05. The IC50 value was determined using logarithmic regression equations (Hussein et al. 2024). The statistical analysis, figures, and graphs were conducted using GraphPad Prism 8.0.

The assay demonstrated that the test drug effectively suppressed the growth of micro-blood vessels in a concentration-dependent manner. This inhibition was observed on day 6 of the experiment compared to the negative control treated with merely 1% DMSO. The IC50 value for 2-NPHC was determined to be 13.42 µg/ml, as illustrated by Figs 1, 2.

Figure 1. 

Dose-response relationship of RAR assay for 2-NPHC.

Figure 2. 

Cultured ex vivo RAR assay concentration-dependent inhibition of micro blood vessel growth for the test agent (2-NPHC).

The blood vessels in the CAM exhibited regression in response to 2-NPHC, resulting in disorganization and a pale yellowish appearance. The avascular zone encircling the disc containing the test drug indicated the inhibition, and the size of the inhibition zone was quantified. The assay result demonstrated a statistically significant regression in the blood vessels of the CAM when exposed to the test agent, as compared to the negative control CAM; this is displayed in Fig. 3, with an inhibition score of 6.5 (++) for 2-NPHC, as indicated in Table 1.

Figure 3. 

The in vivo CAM assay showing a marked regression in the blood vessel growth surrounding the implanted disk (indicated by the black arrows). A. Negative control; B. 2-NPHC (100 μg/disk).

The findings demonstrated that the test agent (2-NPHC) effectively decreased the DPPH free radical in a manner that was dependent on its concentration, as illustrated in Fig. 4. The nonlinear regression analysis calculated the IC50 value for the test agent, which was determined to be 175.3 µg/ml for 2-NPHC.

Figure 4. 

Concentration-dependent free radical scavenging activity by DPPH assay of 2-NPHC.

The results indicated that 2-NPHC had low to non-toxic effects on the HUVEC cell line, with an IC50 value of 711.7 μg/ml, as illustrated in Fig. 5.

Figure 5. 

MTT analysis of the cell viability of the HUVEC cell line after treatment with serial concentrations of 2-NPHC.

The HCT116 gene expression analysis results indicated that the control cells, exposed to the media, consistently expressed the VEGF gene at a stable level. Comparatively, the cells treated with 100 µg/ml and 400 µg/ml of 2-NPHC exhibited a decrease in the expression of the VEGF gene compared to the control cells. There was no significant distinction between the two concentrations, as depicted in Fig. 6. Ultimately, the gene expression findings were congruent and cooperate the ex vivo RAR assay results and the in vivo CAM experiment.

Figure 6. 

Violin plot of the relative gene expression of VEGF in the HCT116 cell line treated with 2-NPHC. ^*Indicate p-value ≤0.05.

There are a lot of limitations involved in the screening of antiangiogenic activity for new substances, especially when it comes to the choice of the screening assay. The in vitro and ex vivo (exclusively RAR) assays are the most commonly used for screening analysis because of the ease of access and the resources required for these assays. On the other hand, the most limited models to further explore angiogenesis are in vivo, in which the CAM assay is the only available model to study in Iraq. The vast majority of these are unavailable, including the zebrafish, the corneal, the sponge implantation, and the dorsal air sac, but most importantly, there is a lack of animal strains specific for tumor and angiogenesis induction.